Transcript Name :
Phypl_g748
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_552331
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pyruvate carboxyltransferase41.698PS50991
Pyruvate carboxyltransferase41.698PS50991
HmmSmart predictionP-Valprediction_id
2-isopropylmalate synthase LeuA, allosteric (dimerisation) domain1.2e-31SM00917
2-isopropylmalate synthase LeuA, allosteric (dimerisation) domain1.2e-31SM00917
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1280.17218
InsideOutsideTMhelix
1-576
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
catalytic activityGO:0003824IEA
leucine biosynthetic processGO:0009098IEA
*** None ***
*** None ***
Sequence
        1730 bases(100 bases per row)
ATGATGCAGACGATCGCCAAGCGCTCGGCCTCCGCGGCCAGGGCCAACGCGCGCCGCGCCTTCTCGAACGCAGCCGCGACCGAGGCCGGCAAAGAGCGCC
TCGTGATCTTCGACACGACCCTGCGTGACGGCGAGCAGTCGCCCGGCGCCACGCTCAACTTCAAGGAGAAGCTGGACATCGCGCGCAGCCTGAGTGCGCT
GGGCGTGGACGTGTGCGAGGCGGGCTTCCCCATCTCGTCCCCCGGTGACTTCGACGCCGTGTCCGCCATCGCCAAGGAGATCGGCCCGATCACCGCGAAC
CGCGCCACGGGCGAGCCCATGACCATCTGCGGTCTCGCACGCGCCATGGAGAAGGACATCCAGCGCTGCTACGACGCTGTCAAGCACGCGCCTAGCCACC
GTATCCACACGTTCTTGGCCACGTCCGACATCCATCTCAAGTACAAACTGAAGATTTCGCGCGACGAGTGCATCCGTCGCGCTGTGGACGCCGTCAAGTT
CGCTAAGAGCCTCACGTCGGACGTGGAGTTCTCTACCGAGGACGCTGGACGCAGTGACCCTGACTTCCTGTGTGAAGTGCTCGCTGAAGTCATCAAGGCT
GGTGCCACGACGCTCAACATCCCCGACACGGTTGGATACACGGTCCCTGGAGAGTACGGATCGCTGTTCCGCTATCTGATTGACAACACCGAGGGAAGCG
ACAAGGCTATCTTCTCCACGCACTGCCACAACGACCTGGGTCTCGCTACTGCCAACACTATTTCCGCTGTGCAGGGGGGCGCCCGTCAGGTGGAGGTCAC
GATCAACGGTATCGGCGAGCGTGCCGGTAACACTGCTCTCGAGGAGCTGGTGATGGCTCTGAAGACTCGCCCGCAGCACTTCCCGGTCTACACGTCCGTG
GACTCAACGCAGATCACCCGTTGCAGCCGTATGGTCAGCCACTACACTGGTATGTCGATCCAGCCCAACAAGGCTATTGTGGGCTCGAACGCTTTCGCTC
ACGAGTCTGGAATCCACCAGGATGGTGTGTTGAAGCACCAGGCTACCTATGAGATTATGCTGCCGGAGTCTGTGGGTCTGAGCGAAAACAAGATGGTGCT
CGGCAAGCACTCTGGTCGTCACGCTTACAGCAAGCGTCTGCAGCAGCTCGGCTACACCAGCCTCACGCCGGAGGAGCTCGACTACTACGTGGAGAAGTTC
AAAGTGCTGGCTGACGAGAAGAAGACGGTCACGGACGCTGACATGGAGGCGATTGTTTCGGACGAACTGTTCAAGCCTGAAGTCTTCTGGACGCTGCAGT
CCGTGCATGTCACCGCCGGTAACCTGGTGAAGCCAACGGCCACGGTCACGCTTGCACACAAGGACGGCCAGGAGGTGAGCGAGGCTGCTATGGGCACTGG
TCCGATTGATGCCATTTACGTGGCCATCAAGCGCGCTACGGGCATGGAGAGCATCAAGCTGAACGACTTCTCCGTTGAGAGTGTGACGGATGGCACGTAT
GCTCTTGGTGAAGTGACTGTGCGGGTGCAGGAAGACAAGGAGGAAGAGGAGAAGACCGAGGACGAGAAGCATGTGAACGCCCAGACGGGTGTCACTCGTG
ACCGCCAGTTCGTTGGACACGGTGCTAACACGGATATCCTGGTCGCTTCGGCTACTGCCTACGTGAACGCTGTGAACCGCATGATGGCATCGCAGGCACG
TGGTGTCACTGAGGCTCGGGTGGACGCTTA