Transcript Name :
Phyra_g8133
Orientation:
(+)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_344165
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Glutamine amidotransferase21.602PS51273
Ankyrin repeat-containing domain17.608PS50297
Ankyrin repeat10.205PS50088
Ankyrin repeat11.14PS50088
HmmSmart predictionP-Valprediction_id
Ankyrin repeat720SM00248
Ankyrin repeat1.1SM00248
Ankyrin repeat360SM00248
Ankyrin repeat0.0001SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
Glutamine amidotransferaseIPR017926
Y-scoreD-scoreY-pos
0.1930.21337
InsideOutsideTMhelix
1-888
NN-scoreoddsWeighted Score
0.5952.5530.005
PositionContextScore
370EAWRKLR|SV0.674
TypeScore
cytoplasmic60.9
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3715 bases(100 bases per row)
ATGAAGTACCTGGCAGTGACCGGCGGCACCGTGAGCGGCCTGGGCAAGGGCATCACCATCAGCAGCATCGGCGTCGTGCTCAAGTCGCTGGGGCTGCGCG
TCACGTCCATCAAGATCGACCCGTACCTCAACTGCGATGCCGGCACCATGTCCCCGTTCGAGCACGGCGAGGTGTTTGTGCTCAACGACGGCGGCGAGGG
CGACTTGGACCTGGGCAACTACGAGCGCTTCCTGGGCATCACGCTCACGCGCGACCACAACATCACCACGGGCAAAGTCTACACGCATGTGCTCGAGAAG
GAGCGACGCGGTGACTATCTGGGTAAAACGGTGCAGGTGGTCCCCCACGTCACGGACGCCATCCAGGACTGGATCGAGCGCGTGGCCCAGATCGGCGTGG
ACGGCAAGCACGCCGGCGAGGCTGCCGCTGTGGACGACGAGGCCGCCGATGTGTGCCTCATTGAGGTCGGTGGCACGGTCGGCGACATTGAGAGCATGGT
GTTCCTCGAGGCTCTGCGTCAGTTCCAGTTCCGCGTGGGCCCCGAGAACTTTTGCCTCGTGCACGTGTCCCTTGTCCCCGTGCTCGGCTCCGTGGGTGAG
CAGAAGACCAAGCCCACACAGCACGCCATTAAGGAGCTGCGCAGCGCCGGACTGTCCCCCGACGTCATCATCTGCCGCAGCAGCACCGAATTGGAACCGG
GCACCAAAGCCAAAATCGGCATGTTCTGCCAGGTGCCGGCCAACCACGTGCTGTCGGTGCACGACGTGAGCAACATTTACCACGTGCCTCTGCTGCTGTC
CAAGCAGGGAGCTGCTAGCATTCTCATGTCCAAACTGCAGCTGATGGACCGCTTCTGCGAGCCGGACCTTGAGGCCTGGTCAGCCATGGCCCACCGCGTC
GATTCGTTCGAGCAGGTGTGCAAGATCGCGCTCGTGGGCAAGTACACGGGTCTGCAGGACTCGTACCTGAGTGTCATCAAGGCGCTCAAGCACGCCACCA
TGAAGTGCAACCGTGACCTAGAGATCGAGTGGATCGAGGCCAGCGACCTGGAGGTGGACATGCGTGAGAACGACCCCAAGGCCTACGAGGAGGCCTGGCG
CAAGCTGCGCAGCGTGGACGGTATTGTCGTGCCTGGCGGTTTCGGTGACCGTGGTGTGGACGGCAAAGTGCTCACGGCCAAGTACGCTCGCGAGAACCGG
ATTCCGTACCTGGGTGTCTGCCTGGGCATGCAGGTTGTTGTGATCGAGTTTGCGCGCAACGTGATCGGCTGGAAGGAGGCTAACAGCGAGGAGTTTGACG
CCGATGCTGAACACAAGGTGGTTATTTTCATGCCTGAGATCAACCCGGAGGTCATGGGTGGCACTATGCGCTGCGGTGAACGCCGCACGATTGTGCACGA
AAAGGAGGACCCGGCGAAGCGCTCGCTGGTGTCTTACCTGTACGGTAAGGACAAGCCGATCCTGGAGCGTCACCGTCATCGTTACGAGGTGAACCCGGAG
CTTGTGCCCGCCATTCGTGAGGCTGGTCTCAACTTCGTCGGCACGGACGAGAAGGGCGAGCGCATGCAGGTCGTGGAGCTCGACCGCGACGTGCACCCGT
TCTACTTCGCCACGCAATACCATCCGGAGTTCAAGTCGCACCCGAGCGACCCGTCGCCGCCGTTCCACGGCCTCATTCTCGCTGCCACCGGTCAGCTCGC
CCAGTTCATGAAGGACGTGGAGGCCAAGGAGCAGGAGCTGTAAGTGCTCGGGCGATTCGAGCTAGAGGCGGTGGAAATTGCTGCGACGCAGAGCAGGTGG
ACAAGTGGCGCGGCAGGACGCAACGACGATGCCTCTCTCGCAGCAGGTTTGCGTGTGAATAGGCTAAAATATTGATTTGGACCCCTCCACTCCGATGTCT
TTGCCTTTGTTTTTCTTCGTCGAAGGAAAACGGGGCGAAGCTCTCTCGGTGGGGTTCCGTGACCAGCCCACGGCCAGGTAGAACTAGCGTTAGACCAATA
GACATATATTTATTCCAACTCAACCGTCTGATTGTCCGCATGAACGCCAGCGAGCCCAGCACTAATGCTTCGGCCACATCGTGCTGACGCACTTGGTCCA
AATGGCTACATCTGAATTTGCTCATTTTCGGCGAATCAGAATGCTTCGAGTGGCACTCAACGTGGCATTTCCGAAAATGTCTGAAGAGCTGCAGGAGGCG
GTGGATGGCTTCTTCCTGGCGGCGGAATACGGCCGCTCCGACGTCATCAAGGCACTGGCGGACCACGGTCGCGGACGCCTGTCGCTTGGAGACGTGGTGG
ATCCCGTGACGGGGCGCTCGCCGCTGCACGTGGCCGTAGCGAGCAGCAAGAAGGACGCGCTGCGGGTTCTGCTGGCCGCTGGCTTCCCCCCGCACCATCA
GAGCAAGCAACAGGAAGGAAAATACACGTTAGAGGGCGAAAATCGGTCGGCGTACGCGCTGGCGCAGCAACTGAAGTCGCATGATTTGCTGCTGGTGTTC
CACCAGTTCCTGATCCAGCAGGTCGCGGCCAACGACGTGCAGAGCGTCACACAGTTACTGACGGCTGGCGTGGATGTCGGCGTGACGGATACAGCCACGG
GAGGATCGCTGCTGCATTGGGCGGCGTCGTGCCAAGCAGTGGAGGTGATGAGGGACCTGCTGGAGAGAGAAGACGTTCAGAAGCAGAAGCTCGTGGATGC
TCGCAACGGGGAAGGAGCGACGCCACTGCACTTGGCGTGTCATGCGAACCAGGTGGAGTGCACCAAGCTGCTGCTACTGCATCATGCTGATATAAGTGTA
CGGGGTGAGAAGGGGGTCAGTAAGGACAAGACGGCGTTGGAGCTGGCTACGATGGCGGAGGTGATAGAATTGTTCTCTCAAGGGCTAGGAGGGAAGAGTG
AGGTCAGCGAGCCCAGGGAAACGCAGAGGGAGGCTTCAAAGGAAGGAGATAAGGATGCAAGCAGCAGTGATGATGTGTCGTGCAGATTGATGACGGTTGG
TGGTGAGCGTTCTGGGGCCTGCCCACATGAAGCGCAGAACAGCAAACTGTTGCTTCAGCTCGAAGAAAAGGATCTCCTGGTAAATCAGTTGAAGAAGACT
ATTGAAGTTCTCGTGCAAGAATCACAGGAAATTCAAATGCTCGGAGAAGAGCGTGTGATGCTGGACTATGTGCGCAAGCTGCGCGATGAGAAGGCTATTG
CCCAGAGGCAGATTGAGGATGCGAACGACTACATCAAGGACCAACAGCAGCAACTCGAAAGCTTGAAGGAGCAGATCCGACAAACATCCAGTGCCACCAA
ACAGGTAAGAAGATTGTTGCTGGCGTTAGTTGGCTGAAAGTGGTGTTCTTACGACTACTTCTTTTATGTAGCAGCTTGAGACTGACCACGACATTCTCTC
TCATACTAGTGATGGTACGGCTAGCAGCGTCGCTGGGGCCCCTCCGAATAGCTCCAACAGCAACACGAATGCGCTGGATTTACACCAGCTCGATACACAG
TTTGATGAAGAGGACGAGAACTCACAAGAACCCCGAGCTCAAGCACTGAAGTTAGATGCCTGGACATCGAAGGCTCAACGTGAGCAAGAAACATTCAATC
GATACGTCGAAAAGCATGGTCCTGACATTTGGAGTACGGTGTGGAACGGTATCTTTACAGGCAATGAAGAGAAGGAGACGCACGATGAAGACGGCGAGGT
CATCATGACGGTGTA