Transcript Name :
Phyra_g7401
Orientation:
(-)
Number of Exons:
4
Description :
DEAD/DEAH box RNA helicase, putative
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA helicase, DEAD-box type, Q motif9.074PS51195
Helicase, superfamily 1/2, ATP-binding domain23.719PS51192
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain1.8e-39SM00487
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
RNA helicase, DEAD-box type, Q motifIPR014014
Helicase, superfamily 1/2, ATP-binding domainIPR014001
Y-scoreD-scoreY-pos
0.2680.2636
InsideOutsideTMhelix
1-432
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        8831 bases(100 bases per row)
TGGACGACTCGCCAGTAGTGGAGGTGTCCGCTCTCCAGCGCCTGCCCCAGCCCGGCGAGCCTATCTGCGTGGTAAGTCTCTTGCGTATCCCTTTAGCGCA
ACTTTCTTACCTCAACTTCCTCGCCCGCCTGCAGATCTGCGGTCGATACGGCGCCTATGTGTGCGACGCCACGGACGAAGACGTTTGCAGTCTCGAGTGC
CGCGACGTCTGCGTGTCCAGGCAAAAGCAGCAATCGCAGCAACAATTTCAACAATCCGAGCAACTTCGCGCCAAACTGGGCATCAATGTCTGCTGTGGAT
CGGCAACTGAGACCATCAACAACGGGGACCTGGAGCCTCGATGGCCGACCCCATTCGTGGACTTTGCGCAAAAACAAGAAGGCGTTCAATTGCCTGAAGA
GTTGCTGGTTAACTTGAGTGCCAACGGCTTTGATAGACCCACGCCCGTGCAGATGCAGACGATCCCTTGTGTGCTGCAGGGGCATAATGTACGTATTGCG
GGGTTGGAGGTTTGTGGCGTTGCTGATATTTTCTTTTCAGGTGCTGGTGAGTGCGCCAACGGGTACGGGGAAGACGGCGTCGTATTTGATTCCAGCAGTT
GCGCAGGTTTTGCGTGCGCGGGAAGAGCAGGAGGAGATTTTGACGCTAGTTGTGGCTCCTGTGCGAGAACTGGCAATTCAGATTGAGACGGTGGCAAAGC
TGCTGGTGAGAGGCATAGCTGACATGAAGACGGCGCTATTGGTGGGGGGATTCCCTGTCCCCACCCAGCGCTATCGACTACAAGGTGGAGTTCAGCTTAT
TGTGGCGACACCGGGGCGCTTCCTCGATATTTTCATGAACTACAGTGGCGGTGATGCTATCCTGGCAGCTATTCGCATGTGTATTGTTGATGAAGTGGAC
ATTATGCTGGACGCTGGCTTTCGTCCACAGATTTCTCAAATCGTGGCTTTATTGGTAGCATTAGCTGGGAAAAAGAGCGTCCAGATGCTGTTTTTCAGCG
CCACCGTCGCTGGCGAGGTAGAAGAAATGGTGCGGCAAATCTTGCAAGTTCAAAGCCAGCAAAATTATATTCGCGTCGACGTTCGTCGCAGTGATTCGAA
GACAACTGGGACACCGAGTTTCGCACTCAACCCTCGTGTTAAACAACAGGTTCGATGGTCGGACGACAAGGTGAAAAAGAGTGAGTTGTTTGAGTTCTTG
AAAGGGAAATACGAAGAGTCAACGGTGGGTGAGGTGATTGCATTGACTCTTATGGAATTTCAAGCTAGCTGACATCATTGACGGGTGGCTGATACTTTTT
GTGTTGCTGGCGTTGTAGATTGTCTTTGTCGGATCGAAACTTGGCGCGAGCATGCTGGCTGAAGCCATTGAAAAACGCTGTCAAATTGGTGCAGCAGCGA
TTCATGCAGATAAAACTCAAAGCGAAAGACTTCATCTGCTGGAGGCCTTTATTAATCTAGAGACCCCTGTCCTCGTGTCTACAAACGTGCTGAGCCGTGG
AATGGATCTGCTGCACGTTCAGAATGTTGTGATCTATGATTTTCCCAAGAAAGTGTCAGACTACGTTCACCTCGTTGGGCGTATCGGGCGTGGAGATGAT
TCGACCGGAAATGTTTTGACGCTTGTGAATAAGGATGACCAATCAGTTTTTTGGGACCTTGTATCGCTGTTGCGGCAAGCTAAAGTATCGGTGCCTCACG
AAGTGTACCAGAGTATTCACACTGAGAATGCCAAGTTGCGCGCTCGCTCCATCGAAGTCGTGATCGATGAATCTAAACGGGCTTTCCGAATTCGGAAGCA
ATTGGTTAAGGAAATGGGTACGCACGCATCAGAATGGAAGAACTGGGACAGTCAGAAGAGTAAACGGCGGCGTACAAGGCCATGATTTATTCGTTAAACT
AGTGTCAGCAAATTCATTTCGAGTATCCGGTGCGACTGGCTATTGATTATTCAGAGCGGTTAGCGTTGATAACCTCGACCACGATTCCTGTTTTGCCACT
GGATGTGATTCGGTCTCATGATTAACTCGCTCTCGTGGTTTATCACGCCTTTGTGCTATTGTCCAGAGGGCTCAGGAGGGGCCCTCCTGAGCGCTATCGC
CTTTGCTCGGAACAAGCATCGTTATAGCACTGCTTTTGACGCCATAATCAAACGCGGGCACAAACCCGCAATTCGACAGAAGTACTTAAATACATGGAGA
AGGGCATGAACACCACGGGCTTCCTCGCTACCAGAACGGTTGCTCCAATAAAAATGTAACCAAACCGCCGACCTCGCTGCTGAGAATTTGCTTCAAGTCA
ACTATCGCGCCCTGCATAACCCAACGATGACACGCAGTAGTGCTGCTCTTGATACTGATCTAGATTAGAGGTGGGGCTTCATGGTGCCGTGGTGTACCGC
ACTCAAACACAAACCCGCCCGATGTGTGATTACCCGAGACGTTACCTCCAAGCACTTGTGCCAGTCCGGGCAACTGTCGAAGAACGCTTCGAGTTTTATG
ATGGGCCAGATACATTCGAACTTGCTCGCGAGGACTTGGCTCTACTGACTGCGGTCGCAGACATGGATTACAAAGGATGGAGATACTTATTCGAGAAGCA
TTGTGCGGTGCCATTGGGTCACGAAGGGGATGAAATGTACGAGGGACACTGGATCGGAATGCTGCGAGGCGTGGATGGTACAGGCACCTCAATATGTTAA
TCAAGGACGAGCAGTGGTGTGCCGAAGAAGAGTGCCGCACGCGACGGTAAACTGAAGATATCCTCCAATTTTTTGTTTGTTTGCACCACCAAGAGAAACA
CAGTAGAGCATGCGTGCACTATTTCGCACAAATAACAGCAATGAGAACTCTCTTGCAGGGCAACAAACCAAGGCTCAACCTAAATATTCCTGTTCACGTG
CACTTCGTTGATGGGTTTGCCGATTTGACAGTGCTAGCGGATATTATGAGGGCAGAGAGAATGGTCGAGGGAGAGTGATGAGCAACCTGATACTTTTGAA
CCCCTCACATGCACCGTTATGTTGAAACCGACCTTGGTGGATTGATCAAGTGGTGGTATCAACTCGGACACATCTGAGATTTTGCGGACTATCGTGCATG
ATAAGGTGTCACCTGGTTATGCAGTCGCTTTGTAGTATCCGGATCGCCGTATTGGCAATTTGATGACAGATCGAAGTGATTAACTGGACATCCTACATGC
AGAAATATGTTGGGTGTCACATTAGGCTTGGATCTTGGTGGAACGACATAGCAGGCGATACTCTAGCTCGTCGAGAGAAAGCTGCTGCTGATGTCTTGGC
TTCGACAATATGAGCAATCTGCGAAAATTTTCGTCTTCCCTTCGCGAAAACGTTGTCGTAGCAGACAGTTCCACGAAGAATAGTGACATCGTCGTTTGAT
GCTGAGCCAAGCCGGTATACTAAGCGAGAGAACCACAACATCAATGTGAACGATCGACTGACGTAAAAAGGTATCACACGAAAGCTTAGTTGCTGACCCC
AAATAGTGCCCTCAAAGATGACCGAGTCTTGGAGTCGTAAATCTCCTGCGAAGAAGATCCGGCATATGATTGCGATGTGGTCAGCGAGCAATAAGCATAA
TATGGTTGCGGCAAACCAACTACGAAATCGAAGCATTTCCCGCATGACTGGAGTTAACGCGTCTAAGGTGAATACCCAGTGTGCCCAAAGCCACCACGAA
ATCACCATCCAGCTGTGCGCGACGTCCCAGCTGTACAAGACGCTCACAGAGATACTTGCAGACGTGACTTGAAAGGAGTAAAACACGAAGTCAAACGAAG
TAAAGAGCAACTTGAGTAGTTGGGGCTGGTAAAATCCAGCAAATAGAGATGTGAACACGCCTGTGCACAGCAGTGCGCTTGATGATACCATCAATATAAA
ATCTTCGTGTGCTGTAGGATCATCATGTGATTCATTAAACTCGTGTGCAAGGGCGACGTGAGAAAGTATCAGTCCAGCTGCTCCAACTGAATACAACACA
ACCATTGACCACAGCGAAAAGCGACGTTTGTTTGCCGTTAGCCAAGGAAGCAGCGTGTTACTCGCGGCGAAGGTCTGAGAAAAGTTGACAAACATTAAAT
GTTGCACGATATCAGTGTCTCTCAAGGATGACATCTTTGCTTTGAACATGGAATCATTCGTTTCCCACGCGGAAGATTCTGCGGTGCTTGCACTGGTTGC
AGCTTTAGTATGGCGCGATAAATGACACATTCAACGATAGCTGGTCTTTTGGGATGAGAACGCAAAACTTTGCGTCTCCGAAGCACAATTTTTGCAAGCA
GAAATCCAAGTGATACCAGTCCGTTTCCGATCACATCCAGCCCCGAGAGCTCAAAATTGCCATGTCTGGTTTGATATTTGAGAATTGAAAAGATTGAGCC
ACTATCCACGTGCCCAAGCATTATCCAAGCAAGTGCAACGAACACCGAAAAAATCGCCGCGATCAGAAAGCAAGTGAGACTGCGGAGGCCCAGAACATGA
GCATCAACACAAATGACGTGATGATATCCTATCCAGTCGATCACCGTCCGGACCGAGCGCAAATCTCCAAAGTACATCGACATCGTAACTACAATCACGC
TTGTGACAACGGAGAAGAACCAGAAGTCGAACGTTCGACACACCAAGCGCACGATATCGTATCTCAGTGTCGTCACACTTCCCAACCCCATAGGGAGCCA
TAAGAGAACGGCCAATATCGACATCACGCAGCCCACTGGAGCCTTGACCATGGGCACAATGGCGTTGATGCAGTAGGATACTGCTGCGCAAAACAAGATT
TCTCGGTAGTACTGGTAGTATCGGCGACGGATGTATGTGTGAACGCTGCCAGGAATAAGCCGGCCTCGAAACGTCTTGGATAGGTCAACGACTGGAAGCG
GCTGGGCTGGTACTAGTGAGTAGATGATGTTGCAAGATGTAGTCGAGCCTCTCTTCTCTTGGGCGGACATTGCTGAATAGCTCACGAGGTCTTGGTCTGA
TGTGCAGTACTTCTACATGTAGTTGGCACTGTAGTTGAGTCGGCAACTGGGGATCGCCTGCTGAGACACTGAACAATGATGTCTGTGCACTGGATGCTAT
CTTTGTTGACCTCACGACCTATTTGTACCGAAGTCTCTCCACCTGTTTTGATGGCTGGAGGTACTATTATTTAGCGGTATATTGTATCACCCATCGATGA
AATACTCGGCTTGATTGAAACGCGCACAATAGAAGCAGCACCCAAGGCGCCAAACCATTTTTCACTTACTGCGGAACGAGATAGTTTTCTAAAATGCATT
TCCTCGATGGAACGATGCATCAGATGACATACATTTTCGTTCAAAGAGATACCTGCTGATGACTTGGGTAGTCCGCAACCTTTCTAAGTTGTCGCGTTTG
CTACCAATTTCTTAACCCTTTCGTGGTAAAAGGAGGCATTTTGCTTCCTTTAAGCACTTTCACAAAAGTAGGTGAAAATGGACCCCCTAAAAGGAAGCAT
TTTGCTTCCTTTTAGCTTTTACCAGGGTTTCAGTAGACCGTGTTTTGTGTAAGCCAATCAGATCTTTAGATGCGGGTGGGTTAGGTGCTCCCACTCGAGG
ATTTGAGGCCGACTATCAAAATTTAAATGCTAATTTTGCACGAAAGCGCCCTGTTTTCACCCCATATCCCGTGATTTTTGTGGTTTTGCGGTCATTCACA
TGAAACGCAATGAGGAAATGGTGGGTACAGGTGGTGGAAACGAGGTGGACCCATCCCAAATTCTATCCTGGACCCGCGTGATGCTGCGCCACCAGTTCGG
GCGTCCAAACCTATCTCATACAATACTGAGGTGAGATGCTCGCCTTCACTCCTTCATTTATCGTCAGTTTCAGATGCGCACAAGTTTTTCCGACGCAGAA
GACAAGAAGCTCGTTGTTCGTGCCCTCGAGTATGAGTCCCACGGCAAGCGCGTTGCCTGGCAGGACATCGAGCTCAAGATGCGCAGGAAGCGTCCGGCAG
CACAACTCAAGATGAGATTGCGCGCTCTAAAGCGTACCTACAGTAACGACCTCGGGCGTTTCCCTACCTGTTTTTTTTCCACATGTTCGCCAACGCCTCA
ATATGTGAACAAGTTTTGCCTCCTGTCCCCAAGCCAGGCTGAAAGAGCCATCCGTGAGATTTTTGGAGCTGTTTCGGCTGCTGATGTGCGCCAGGAGGCA
GGTAAAACTGACGGAAATGCCGGGGAGATGATTCTTGCTGCGGTGTCGGGTATCATTCGAAGTATTGGAGCGGTGAAGCCAGATGATGTCTTTCTAGACA
TAGGCGCTGGTTTGGGAAATGTTGCTGCACAGTTCGCGTTGCAGACAAAAGCTAGACAGTGTTTGGGGATCGAGAAAAGGGTGGATATTGCTCGCAGGGG
GTATGAGTGCGTGCGATCATGTGCGTCGCGACTAGTGCTTCTGCACAAGGTAAGTCTGAAGTCTGGGGACGTACGCGATACGCCGCTGTGGTCGTCCGCA
CCATTTCACGATGCAACCATCATTTTCCTTAATGATTTCCTGTTTGATGAAGCCGCCAAGCTCGTGGTGCAACAAGAGCTTACTCGCATGCCAAGAGCCC
GACTGATAGTATCCACGTCTAAGTATTGCCCCCGCCACCGTGAATCATGCCGCAACAGCTTTTGCGCGAGATGGAAATTGACGGCAACTACTTACGGCCG
CGGCAGTTGGAAGGCACTACCACTTCCAATATACATATACAAACAATGCTAAAAGCCTGCAACGGACTTGCGCGACTGGACTTGACGCACGCATTCACAG
CGGCCATGACGCGCTGGGCATCGTACACGGCAGCAACATCGCGGTCAAGGCGCAACTGGACTTGGTGCAAGCGGGCACGGCGACTACGGCGCGCTGGACT
TTGTGAACGACAGCTTGGATATGGCGCGCACGGGCACGGCTGGATTAGACGACAGCGGGCGGCGACGGGACTTGGCGACTGCGAGCGCAGCTCAACAGGA
CTAAGCGAACACGGGCATGGTGGCCACGGCACTCCGAGCTGCGTGCACGGCGGCAACATATCAGGAACGTCGGCCACGGGACGCTGAACTTGGTGCCGGG
CGGCAACAGCGTGTGCTGGACTTTGCGCACATGTTTACGGCGTCCACAGCGCGGGCGCGACGCGAAAGGACTTGGCGCACGACAGCTGCAGCTTGGGATG
GACTGGGCGGCCGCAGTCTCAGCGCGAATGGACTTGGTGAAGGAGGGAACGACGGACACAACGCGGCTGGCGGCGGCTGTCAAGGCCGTGGTGATGCCCA
GAACGGCGCAGTTGGCCTACCACAGGAACGTCGCGGGCACTGGGCTGCAGTTGGAGCTGACGCTGGCGATGATGGCCGAACAGATCCCGCGGCGATGGCC
GTGGGTGCAACGCTGCCACTGTGTTATTTGGGACGAGAAACACTTGTTGATAATGCTAAAGACATTGACCATAGTTTATTCGATATATATTCGGTCATGT
TGCTCTGAAGGCATTAGCATACTTTAATCAAGATAAATACCCTCTTCTTTGCCTACAGAATGCGAATCATTGGAATATCTGTCGCGCAACTCTGCTGTCT
TGACTCGCTGAATCTTCGCTGAGCAACTCTGCACAATCACTACTGAAAAGTAGGTCGGTTTCGTCGACGGAGAGTACAGAACTGTCGCTCTGGGTCTCAT
AAGAGAGCACGACACTATCGCTTTCGGGGATAGGGAGAGCTTTATCGACGGGTCTCGCGGCGCTACTTGCCTTCAACTTAGCCAGATGCGATGACCTGTT
GACATTTCCATTGTCACTGAAGAGTCCATTTGGGAGATAGAATCTGTGAAACTTATCCCAACAAGTCCAAGTGCTCTGTGGGCACGTGTACGGACTCTCG
ATGTATCCATGCACAGTGCTACAAAGACAAACAGTGTGCGTGAGGCAATAATCCGTCACCTCTGTAGGATATCTGCCCTCGTAGCGACACACAATGCACT
GCCGACGTTTCCGCCCACTGTCCTTGAACATTTGTTTCGAAGGCATAGACTGACATCGCTTCAGGGCGCTGTGCGGGTTTGGCGAAGTGTACACTTTAGG
AGTTATACCAGTTGCATCCACTGCTGCGATTTCATCAGCAACACCGCTTCCAAACGCCATTTGACCATCGCTCGGGGCTTCTTGCCACCTGCCAGAAATT
AGCTCAGATACTAATTCAGTGACAAACGTCCTGTGGGGATCTCGATCTCTGGAAGTGTCGATTGCCATCCGTCGAGTCAGGTACGCGTTGGACCGTGCAA
TATCCACTATTGCCAAAGCCAATTTTTATGCCATTTTTTGAACGAATGACCATCAGCTAGTGAAAATCTAGCTCGTATCTGATCCAAACGATCAACACCT
TGCATGCGTCGATTGTATTGCAGGATACAGCTCGGAGCAGGAAACTCATGAGTATTTTTACCAACCCGCCGCGTGACTGTCGCGGCAGTAGATGCATCAG
CATTGGTAACCATCATCACGGTATTGCCATCGCACCACGACGCACCGAGCAAGTTGTGCTCCAGGGAGACAGACTGCTGATAGTCACCCCTTGTTGAGTG
CTCCTTCTGGAGAATAGTGTGCTTCGGATAGTGCTTACTCCTTCCCCGAACAGTTCCCCGCCCATACAACCCCTTCAAACGCAAATCCAACAGCAACTGG
ACGCTTGTGTAATAGTTGTCCATATTGATGATTCGTCGAGAGTAAAAGTAGGGCCTCACGACCTCTAGAACATGCTTACGCACTTGTTTGACATCCTCGA
GCTCCTCACGAAGCTGCTGCACCTCTTCTAG