Transcript Name :
Phyra_g5533
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_263625
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1840.2927
InsideOutsideTMhelix
1-112
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2570 bases(100 bases per row)
ATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGC
CCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAA
GCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATA
CGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCA
CGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGA
TAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCA
CGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTT
AGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCG
TAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGAAAGCTTTGGTGGTAAATGAGAACTGT
ATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCAT
TGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCA
CTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACATACTTGCTATTTCGGTATACGCGGGCATGGGTGTTGTCGAGGAAGATATCGTTTCGCTGCA
GCCATTGGTGTCAAGGGTGCGTCGGGGCCATAGCGTTCTTCGTTGGAACGATGGGATACACGGTTGGGCGTCCCACACCCGCCGTAAGGTCGATGCTACT
GGGGCTAGCCTTGCCGACGTCACTAGTACAATGAAGGATAGAGTTGACACGATGGCCGTCGAACAGGTTGCGCTTCCTGCGCGATTCGTGTGGGATGCAG
TGCGAATTGAATTTTACGGTGCAGATAAAGGAAACGTCGTGCGCGGGCTATCTGAGCCCCAAGTTCTTCGTCGTGTGTACCAAGCGAGGTGCCGACACTT
CAGTGAAGATGTACATGGAGCAATTGAAATTCCGCCACTTTCTTTGGCGCTGAACGAAGCCGTTTCCATCTTTCAGTTTCACTACGTCACGATTAACCGA
GAGAATCTAAACAATCCAACGCGACTAATTGGTTGGGCGCACCCTTCCCTTGTGAATCTACTGCGCTACCATGGAACTACAATTATCGTCGACGGTACAT
TCCGTTGCGGACCTCGTGGCTACAAACAGTGTGTGGTCTTTATGGTGCACGACCGAGCTTCGGGGCTCTTTGTACCTGTGTACTACGTGTTGAGCACTTC
TCGTAGTAGGGATCCTTTTTGGGACATGATACACTTTGTCGTACAAGGCACGGATCAACAGTTGGAGCCTGCTGAAGTAGTATGCGACTTCGAGAGCGCA
CTAATTGATGCCTTGCAGACGCAATTCCCCAATGCGATCGTCATCGGCTGCCTATTCCACCTGAAGCAGGCGCTCAGGCGCGCTATGAAAAGGTTCCTGA
TCCGGAAAAGGAGTGCGGTATAGCTATGACGCGTGGTGTTCTCGACATGCTTACTGTCATTGAGTATAGTCTCATTGAGAACGGCAATAAATGGGTGAAG
CGTGAGATTCGTCAGCGTTGTGGTGCAGCTGGAATCGAGTATTCCAAAGCTAAGTGGTGTGGGTTCTCGGATTACTTCCAGCGGACGTGGCTAGAACTGT
ACGACGTAAGTGTGTGGGACGTGGCCGGTCTGAATAATGAACTCGTGGCGCGTACGAATAACCCGCTAGAGAGGTTTAACAGGGAGCTCAACGATCGCTT
TCTTAAGCCTCGTCCTAGTTTGGCGACGTTTGTTGGAGCGGTTAAGACACTCTCGGCTGAATACATACAGCGCCTTGCTGACATTCACCGTGGACGCGTG
CGCCGCCCAGTCCGTTAACGAATTCAGCTGCCTGCGCCGGTCGATATCCCAGCTGACATCGTTGATGACTCTGACGACGACGAACCTACAGCAGTCGAGA
TAGTATCCGAAGGATCGACGGACGAGGAGGGCAAGGCTAACGATGAGAACGAGGAGGAGCTGTTTCTGTA