Transcript Name :
Phyra_g2789
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_514023
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.150.16422
InsideOutsideTMhelix
1-158
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        476 bases(100 bases per row)
ATGAAGAAGAAGAAGACGCGGATTACTCTCGCGCTTACGGCAAATGCTGATGGATCCGACACGCTGCCGGCACTCTTTCTTGGTCACGCAAAGCAGCCCT
ACTGTCTCAACAAAAGCACGGTGGCACAACTAGGCTTCTCGTACCGCTCGAACAAGAAATCCTGGATGACAGGACTACTGTTCCGGGAGTGGCTTCTCGA
TCTGGATCGCGACATGCGTGCGAAGGGCCGTCAGATCCTGTTGCTGCTTGACAACGCATCGTCCCACCACTGGGGCGATATCGTGTGTACTAACGCCCGC
GTAGAGTTCCTGCCACCGAATACCACGGCATTCCTACAACCCATGGACGCAGGAATCATCGCCGCGTTCAAGCGCGCGTACAGGGGAAAGCAGCTTCGTT
GGGCGTACGAGAAGGTCAAGCGCGGTGAAGAGCTAAAGAAGGACGTTTACACTGTCGACCAGCTACAGACAATGTA