Transcript Name :
Phyra_g12106
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
G10 protein1.6e-30PR00322
G10 protein1.6e-30PR00322
G10 protein1.6e-30PR00322
G10 protein1.6e-30PR00322
G10 protein1.6e-30PR00322
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1030.057163
InsideOutsideTMhelix
1-630
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleusGO:0005634IEA
*** None ***
*** None ***
Sequence
        5990 bases(100 bases per row)
ATGAGTACAAGTGCAGACACGAAGAAAGAGACGAAGGAAGAGAAAAAGGCCGCTCACCCACCGTTCGATGGCAAGGACTTCGAGGTGTGGTTCGAGCGCA
TGAAGTTGAAGCTGGAACGCAAGGGAATGTGGAAGTACTGCGTGAAGGAGATCGAGGAGCCGGAGGAGTCGAAGCAGAACGAGCACGACGCGTGGATGAA
GGACTCTGCGCGCGCTAAGGAGCTACTCTATGACGGAATGACGGACAAGATAATGAAAACGGTGAAGTTTGAGCCGACTGCGTTCCGTGTAGTGGAGAGA
CTGAAGCAGAGATTCGTCGGGAAAACGTATTTCAAGTATGCAGCGGAGATGACACAGCTGAGGAAGCTCCGACTCCAGGAGAACGGGAATATGCCCGATC
ATTTGGGTGAAGTGCGAAGATTAATTGATCGAATTGCTCTATTGGGTAAACCTCTTGATGAGTATGAGAAGCCTGCGATTTTGATCGGCACACTGCCTGA
CGATTACGATAACGTGGTGGAAACATTTCTGGCAAGTCACGTGCCTCGAGATGTAAATGACCCTCCCAACTATGATCAATTGGAGCATGCATTGGAGCTC
GCGTATGATCGGCGCCAAGGACGAAAGCTAAATGAAGGCAACGAAGATCAAGCCTTGTTTGGAGGATCTGGTAGAGGTCGGGGCCGAGGTCGTGGTCGCG
GTCGTGGCTCTGATCGTGGCCGCGGTGGCCGCAGTGGAGAACGTGGCCGAGGCAGAGGTTTTGGTCGTGGTGGTGGTCGAGGAGGTAGCCAAGGAGCTGG
ACGCGGACGTGAAGGTCAAGTCACCAGTAAAGGAAGATGTTTTCATTGCGGAGAGCAATCGCACCAAGTGCGAGACTGCCCGCACTTACCGCCAAGTGGT
GCCCGCGGATCCGAGCCACCTCAAAAGCAAGCCAAGGTAGAAGGAGCGCAGGGGAAGCGAGCTGCAAAGAACCAGTATACTCAGGATGAGAGTGATGAAT
CGGCATATGTGGTTAGTGCTCTCATTAAGCAGCCTCCCAACGTGCAGAAGTTTGCAAGCAAGCGCTGGTACTTGGACTCGGGAGCCACAAGCCATTTGAC
TAACCAGAAAATTGATTTTATTTCGTTCACGGCCATGAGTGCATTGGTGAGAGTTGGTGGTGAGAACTGGTTGAGTGTAGCTGGAATTGGCACCGTGAAA
AAGGAGATCCAGACTACGAGTGGGTGGCGGACGTTAGTACTGCGTGGAGTACGCTATGTACCAGAACTGCAATGCAGTTTGTTCTCAGTGCGGCGACAAA
CCGCACAAACCCTGCCCGCAGATGAGAAGGTTCGAGTTCACTTTGATGACGATGAATTCGCAAAGGTGAAATTTGAACAAGGAAGTGCGAAGGCACATGT
CGACAGAACCAATCTTTATTGCTTAGAGCTGGAAAGTCCTGTGGACTCCGCATTGGTCGTCGCCATGGATGGAGACTACAAGGTGCAGCTGTGGCACACG
CGCCTTGGTCACCCAGGACGGACAATATTCAACGCACTATTTCGACATGCAGATTGGCCATTGTTAGCTGTGGATCTCAGGATCAGACAAGATTTCAGCT
GTGAAGCATGTGTGAGAGGCAAGATGACGAGAAAGAGTTTTCACTCGGTGCAGAGTTCGAATCGTGACTGGTTAATTGGAGAACGAGCACACGTGGATGT
TTGGGGGCCGTATCCAGTGGCGTCATACTCGGGCATGCGCTACTTTGCTCTCTTCGTCGATGAGGCGTCTCGCTTCTCGACTTTGTTTCTGATGAAAGAG
CGCACCAACGTCTACGCAAAGTTCCAGTTCTACTATGAGCGAGTAAAAACACAATTGAAAATCCGAATGAAAGAGCTTCGTTGTGATAATGCTCGCGAAC
TACTAGCGCTCGGTGAAAAGTGCAAACGCACGTACGGAATGGAGTGCTCGCTGACGGTGAAGCATACCCCAGAGCAAAACGGAGTTGCTGAACGAATGAT
TCGCACGGTGACTGAGAGGATGAGGTGCTTGCTGGAGCATTTTGGACTGCCCAAGCAGATGTGGGCGGAGGCCGCTGCCACCGCAGCGTATTGTGTAAAC
ATAGTGCCGAACAAGAGAAAAGGAATGCAAGTCCCGTATGCAGTGTGGTTCAGAGAGACACCTGCGTATTCGAGACTTCGGACATTCGGTTGTGCTGTGT
TAGCTTACGTTGACAAAGTTGAGCGCAAGAAAATGGATTCACGAGCAAAAGAAGCTGTATTTGTTGGTTATTCTCGTGAGCGAAGAGGCTATCGGTTGCT
GGACAGCAAGACGAACAAGGCGTTCTACAGCCACACAGCGGTCTTCTATGAAGATAAACCTGGACGAATCCTGTTGAAGGATGGTACAGAGGCACCAACT
GTCCCCACGTCGGAGTATTTGGACATTAATGCTACGACGATGCAGAATATCCCAGCTTTGCTGGAGGAAGCTCAAGCTGAGGAGATGCCTGACTCAGAGT
GCAGAACTGGTGGGGCTAGTGGAGGTGCAGTGCCAGCTGAGGTTGCAGATGAAAGTCGTGCACAGCAGATTAGTGGTGCTTCTCGTGAGACTACTATATC
ACGAAAAAGAGCGCGAGCGAGTGGCATCTCGGCTCCGCGCAAAAGAGTCCGCATAGACGAAAAGGTGGCACCAGGTGCAGAAGCAGCACCGGTGAAGGAA
AATGCTCATCGTCAGAAGAAAAGAAAAAGAGGGAAAAGAAAGAAACCAAGTTGTGAACGGTGCGATACACCAAATGAAGAGTCTGATGGTCCGGGCAGTA
GGCGGTGTGCGACACCGGCTGTAGAGCAAGATGATAAGGAGACTGAAGGGCAGCAATCTTCCACTCGTTTGCCTGGTGTGATAGCGACCACCAGCAACGA
GACGCTGGATGCTGATGGTGACTCGCCGATGGGGGACCTTACCGTCTCTGAGCAGCGAGATGCACCTCGCAGTAAGGCATCGAAGACTGGCTGCAGAGAA
TACCGGACGAAGAGTGGCCGAGTGTCGAAGCCACCACGGTGGCTAAGCGACACCATTCATCTTGCATACGGAGACTCAATTGAGAAGAAGAGGTCAGCTG
GTTCATCAAGCTGGGAGGTGAAACGTGATGAAATGCAGTTTGAAATCGCAAAAGAGAAAGCAATGGATTGGTGGCAAGATTTATGTTGTCTTTCGGCCAG
TATAATTAATGAACCAGAGACCCTTGACGACGCAATGAATAGTGAATACTCAGAGGAGTGGCGATCAGCAGCAGACATCGAGTACCATGCATTGAAGAAA
AATGGCACATGGAAGCTGGTCCCTCGACGGAAAGGGATGAAGGTGCTCGGAAATCGGTGGATATTTCGTGTAAAGTATCTTCCTAATGGCAAAATTGAGA
GGTTCAAAGCCCGACTGGTGGTCAAGGGCTTTATGCAGGTCTATGGCGTGGACTACCTTGAAGTATACTCACCTGTGGTCCGCTTGGAGACTCTGCGGAT
GTTGCTGACGCTGGCTGCAATCTGGGACTACGAAGTCGACCAGATGGACGTGACGACCGCATTCTTGAATGGCCCTATCGATAGAGAGGTGTACATGGAG
CAACCAAAGGGGTACGAGGAAACAGGAAAAGAGGACTGGGTTTGCATGCTGGATAAAAGCCTGTATGGCTTAAAGCAAGCCCCTCGTGTTTGGTTTCGCC
TACTGAAAGACCACCTAGAAAAACAAGGTTTTACAATAATGAATTGTGAGGCTTGTGTTGCTGTGAAAGAGATTGATGGTGAGCTGGTGTTTATCTCCAT
CTATGTGGATGATTTGATTCTCTTCGCCCCCAACAAGAAGTTGATGAAGGAGCTGAAGCAGATGCTTCACGTGCGTTTCGAGATGAAGGACTTGGGGCCG
ATTCACTACATCTTGGGCTGGGAGATAATGCGGAACAGAATGGAGCGGACAATTTTCATCAACCAGCACAAGTATGCTGACAAAGTATTGCATCGATTTG
GAATGGAAAGATGCAATGGCTGCAAAGTGCCAAGCACTCCTGACTTGAAGCTATCGAAGGTCATGTGTCCGACCACGAAAGAGGAGAAGGGCTTGATGAG
TGGAAAGCCGTACCGGGCTGTAATTGGCAGTCTAATGTACTTGATGTTGGGCACACGCCCTGATTTGGCTTACCTGGTCCGTGAGTGCAGTCAATTTCTC
GAGAACCCTGGAATTTTGCACTGGCGCGCTGCAAAGCGTGGGCTACGTTACTTAAAGGAGACGCAGGACTGGGGCCTACAATTAGGAGGAGTGCAATGGA
GTCAGCAGGAATTGAATGATCATCTCAAAGCTTTTGCAGATGCAGACTTTGCGAACCGAGTGGACGATCGGAAGTCTATTGCTGGGTATCTCACCCAGTT
CTGTGGCAGCACCATTTCTTGGGCAAGCCAGACAGAACGAACGGTCGCTTTGCACACGACAGAAGCAGAGTACATGGCGCTCAGCCTTCTTGTCCAAGAA
GTCATACACCTGCGGCAGATGTTGAAAGAGCTGAAGGTAAAGCAGGACAACCCCTCAGATGTATTTGTGGATAACGAAAGCGCTCGAAAGTTGGCGAACA
ACCCTGAATTTCACAGTCGGACAAAACACATTGATGTGCGACATCATTTTGTCCGAGAACGTGTTGAGCTGAACGAGATTACTGTGAAACGAGTCGCTGG
GACTGACAATGTGGCTGATGCATTCACGAAGCCACTACCTCGTGTGAAACTTGAGCAACACCGAGCAAGCATGGGTTTGATTTCCCAAGGGCAATACGAG
ACTACCAAAAAACTTGTGCAACGTTGACAACCAGTAGGTGGGGCTGTTGTGAATTACTGGTCCTCACCGGTTGCTACTGTTGCAGTTTAGCTTTTGTCTT
ACAGCAAGTTGAAGTGTAGATACACAAAATGCTCAGGAGCTGGGAAAGGAGAGAGAAAAGCAAAGAGGGGGAAAACCACACAACAGAAAATACAACGGGA
GCAGCACGTCGCTTTACTCCCTCGCCCCGTGTTCGTCTTCTCTTTCTTGTTCGTTGTGCGGTGTGAGTTGCTGACGCACGCAAAAGCAGCCAAGTTACAA
GTAGTACAAAGACCGTCTCAAAGAGGGGGAGACAGTAGAGTACGCCCGTGCTTCCGGCGTTGGTTCCGTCATTGCGATTCCTGAAGTGTGACACATAACG
GATACGACTGAGCACAAGTATAACAGGTTGCTATTTTTCGACATACAAAAAACGAGTCACGCGACGACCCTGTTGCATTTCCGATAGTGTGGGCCATGTC
CAAGTGGAGCAAGAAGAACCGCGCGCCCGCGGGCTACGCGTACATCGAGCCGGTGATGGACGCGCTGGAGCGCGAGCTGCGCGAGAAGATGAACGAGCCG
CACGAGGGCAAGCGCCAGTGCGAGGCGCTGTGGCCCGTGCACCAAATCAACTGGCAGCGCAGTCGCTACGTGTTCGACATGTTCCACAAGTACCACAAGA
TCCCGCGCGAGGTCTACGACTACTGCGTCAAGCGCAAACTCGTGGACGCCAACCTCATCGCCAAGTGGAAAAAGCCGGGCTACGAGCGATTGTGCAGCAC
CTTTGCTATTAACCCAAAGAACTACAACTACGGCACCGTCAGCATCTGCCGCGTGCCGAGGCAGCAGCTCTCGGAGGGGCAGGCGGTGCAGGAGAAGCAC
AGCGGCTGCAGAGGGTGCGCGTCTGGACCCGGAGGGTACCACAACATCTTTGGCAACAAGTACGGGCAGTACCTGGCCCGGATTCAGATCGCCAGGGAAG
ACGCAGCCAAGGATGTGAAGCAGATCTGGGCCACGGAGGAGGACGAAGACGGGAGTGGAGAGGAAGATAAGAAGAGGAAGAGGCAAGAACCGACCCAGGA
GAGCGAGAGTGAGGAGAGTGAGGACAGCGAGAGTGAAGAGGAAGAGACCAAGGAGTCTGAACCCCCATCCAAGATGCAGAAGGCAGAGTG