Transcript Name :
Phyra_g12091
Orientation:
(+)
Number of Exons:
5
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase12.75PS50878
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0430.0916
InsideOutsideTMhelix
1-1183
*** None ***
PositionContextScore
13SWKRFAR|EL0.586
1012QRARLRR|YA0.685
*** None ***
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
*** None ***
*** None ***
Sequence
        11583 bases(100 bases per row)
ATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGT
GTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCT
CAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAG
ATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCA
ATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAA
GCTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTG
AGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGC
AGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCAT
TCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAAC
CTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCA
ATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCG
CCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCG
ATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTC
GTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGC
AAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGA
ATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAG
ATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTTGGACGACGTGAAGGCCGCATACGCACATG
ATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCG
TGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAG
TACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCA
AGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTC
CATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCT
GCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGG
ATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAAC
AGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAAC
AACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAA
GTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCA
TGGCGACGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTG
AACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGA
AGCTGAATGCCGATAACATCGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACTCAGAACCTAGCTAAACATGCAGTTTC
CGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATG
CGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGAC
GCGCTTCGAGACGCCAGAGAGTCTCGTCCCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTTAACAAGCTCAGCTCC
TGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCTCCAAGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCCCCC
CCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGCGAATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTC
GTTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACGGAATGTCCTGATGGAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACCG
CCACCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCG
CCTGAAAACTGGCGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGGACGTGTACCCGTTGACGTCCCGCTCGGTGATGCGTACTGCTCCAGGGTAGCA
GTACTCACAAGCAGTGTCATAAGGCACTGCGCAAGGAAGTCCAATACCGACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCTCG
TAGCGCTCCCGCGCCTGGCTAATCCGGTCGCGATAGCCAGCGGGGTTCTTGTTGAAGTTTTCAACAAAGGCACTCCAACTTTGACAAAGTGCCTGCCACT
CGGGCACTTTGCTTCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGAGCTCATGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGATTCGTTAACGGATC
AAAGTGTACTCGCTTCGCGACGTCATCGTCAACGATGGCGTTGCACGAGTACAGCGCGTACAGATTCGGTGGCGCGGTCGCACCGAATCGGCTGCCGATC
TCAGACTGAGACGGCATCCACGGCTCGCGCACTGGCTCAGTGTGCGAGGCCGCAACAACAGCGGATGGAGCAGAGTCATCTCCATCCCGCGGAGTCGTCA
AGGCTCCAGCGGCAGCGAGCGGTGTTCCACTGCCGCTGCGCGAACGCTTCGAGCTCGAAGCGTTCGAGTCGTCCTCGCGTGGACGACGCAGACCCACATT
GGGGTCAGTGTGGCCCGGAGACAAGATGTCCTTGTCTCCTTCGAGTTCCCCCTCCTCGACTTCGCTTCCGTAGTCGAGGGGAACTCCCTCTCCACCCGGA
GAGTAGATACCCACTCCGGTTTCGACAGCAATGATCTTGCCTGTCTTGTTTCGGATGGCATGTTTCTCATGCCATATCGAGTGGTATCCAGCAACAGAGA
GGCGACTCTCTGTTGCCGCGCTTGTCGACATCGCCGTCGAGGCGATGCCAGTAGCGGTCGTGGCTGAGGCAGCGGCCGTCGTCGCCTTGGAGGCGACGAC
AGCACTTGCTCTTGCCGAAGCGGCCGGCGTCTTGGACGAAGACGTCGTTGGCGTGCTCATTGGGAATGAGCACGTGTTCTCCCGAAGAAAATACGGATTG
ACGTGTCGAGACCGGCACGTCAAATCCTAACGGGGGGATGGTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCAT
ACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGAT
AGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCA
AAGCTTCCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAACTACTCCTACGCTTCCTCCTACACGTGCG
CACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACAACGATCGCCCCCTGGCCAAGCTATCCAGATGTGCGACGTGTCCTTGGTTGACTAGG
TGAGCCCTTCTTCGGGTAGGCCAATGTAGTTCCTTCCCCGGGATGTGTGGACGCCACTTGTGTCTTGCAAGGCAAATCAGAATCTATTTAAGCAAAGGTA
AAAGTCCTAAAGATCTCTCTCCCTATCCCCATCCCGCTTGCGTGCCCACCGACTGCACATCACACTTGAACTTCCATCTGTATATCTTGACCTCGTATCG
GAATGACAGTAACATTGTACCTAGCATCCATCCGATCCAACTGTACCACTGTGGCGGTACCATGTCGATCTGATCAGGTGAGTCCAGATGATCGCGTATG
CCCAGATGATCGCAGATGTCTGGTTGATCGCAAGCGTCCGGATGATCGACTGTACCGAAAGGGTGGTACCAGGCAGATAAAATTACCTGTACCATCATTG
TGGTACCAAGTCAGGTGCTGGGCTATCCGGACATATCCGGCACCAACCCCAACCCTTCTGGTCCAATCAGTCCAGACGCGATCTCTTCCCATCATCGGCA
ATTTGACCCAGGTCGCTTCACCTCACTTCCTCAAGCGCAAGGTGCTGTGTGACTCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGG
TAGGATTGGACTACCTGAATCCTCTGTGGTCTCAAGCATTGAGCCACCATGGATCGCAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTC
GGAAGATGGCGGGCATCTTCGGGATGGATACCCTCCAGAGCTTGGCGGCAGCAACACCTGCCGAACGGCTCGAGCGCGTAAGCGCTTTCGACACGTACGA
GCAAGGGCTAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTGTGGCTGAACGGAAACCAGTTCAGCCTAAGCTTTTGAGGCTGAAGGTTAACCTCTAC
GAAGGAAAAGAAGGGGGAAATCTTCACTTCTGGGTCCGAGAGATCGAGCTCGCTGTGGACACGGCTCTCGTCTCGGACGAGCGACTCCGCGTCGCTTTTG
CTCTCTCCCACCTAAGTGGTCGAGCAAAGTGCTGGGCGTATACGCGCGAAGCGACAACGCCTGGATGCTTTGCATCCTGGGCTCAGCTGTGTGAGCAGCT
TCGAGCCGCCTTCCTCCCGGCGAACTATGAGTACCGCCAGCGCTCACACTTCCTTGCGTGCAAGCAAGGGAGACGTGAGCTGTATGAGTACATCCAGAAG
ATGCGGGAGCTTACCGCATCTCTGGTGGGAAACCCACTCCATAAACACGGTGTTCATGGACGGCCTACGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGG
GTGCAAGCAAGCACCCTGGAAGAAGCGATTCAAATTGCTCTTCAGGAGGAGTACAGCCATCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGGCT
CCACTCAGGGCGGGCCCCAAAGTAGGGGCCCCTTCAACGGTCCTGTGCCGATGGACCTGAGCCTTGCCGAACAGCACGACATGCGCTGTTTCGGCTGTGG
CAAACTGGAGCACATGAAACGTGCGTGTTCCGCGGGAGGAACAACCCGGCGGTTTCCTTCCAAGCCCTTTGGTCCTAGGGGTCGCTGGCAAAAGCCACGA
CCCCGTGGCCAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGATCTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGA
AGGCTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGAGGAGGGCTGCTTGTAGTACATGCAAATGTACGGGGATACGATCATCCCATG
AGAATCTTGATCGATTCTGGGGCGTCAAAGAACGTTGCACGCCGCCGGACGGTCGCTCGCAAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGCAAAG
GGAACGGGCATGTCCTAGTCAGACTGGCTGACGGGACTGTAGTGGAGGTGCCCAAGGTCTTTATGGACCTGTCCGTCAAGTTTGAGGACTTAATTCCACT
GAACGATTCCTCGTTCTTGATATGGACAAGTACGACTTGATCCTGGGCATGCCATGGCTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCA
TCGGGGCTAGCCGGCCTGTTGCTACTGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCAGAAACGA
CTCCGAAGAATTAGTTGCGGCAGGAGCCGCAACAGGTGTCATGACACCGTCCACGGCGGGCAATGGGCCGCCACAGGCAATGCCGGTGGACAGGACTTCG
AGTCCAGCGAGGGGAACTGCAATGCCAGCAGTACCCACCGCTCCTGACTATGGCACCGTACGGCCTTCGGCCTTGTCGACGCCGGGGGAAGTCAACTCCC
CAAGGGAAACGAGCCCACGTGAGACCAAGGAGGTCGAGACCGTGGCCAGGGTCGAGGTTGCTGGGAGCACCTCTAGTGTGGGTAACAATGTGCCACACGG
AGTCGATGGAACTCCCGACTCCACCCTTGAGTCACCACCGGGTGTGGGTAACAAAGGACCACGCTGTGGTGGGCATTGACGACGTCATCGCCGCCGTAAG
CCGGTCTGTTGGGACAGACTGGAGTCGCTACAAGCGACTCGGAGAGAGAGAACTCTCCTCAGGCACGGCCGGACGAAGAATTCTATCACTTCTTCGACGG
CGAGACCGGGTGTACGGTCAAGGCGGACTCCACAACATTGGCAGCTCTGAGGTGTCCGAGCTACTGAGCCTCGAGGAAATGTCGATGGACGATTTCCTGG
CACAATTGAAAGCCGGGGCAATCGCGGAGATGGTGCTCCTGAAGCCGGAGGCCTCTCCAGAAGAGCTGAGCTCCTCTTCCGTTATGGACAAGGATGTCCT
GGGCGAGCTTGGCAAGAAGCGCGCAACGCGTACGGGCTCTGCGATCCTCGAGAACCCCAAGGATCCAGTGTATCCTTTGGTGAAGGAGTTCTCGGACGTG
GTGTCCAAGGACCCGCCGTCCCAACTCCCACCTGACCGAGGAGTTAGGCACGAGATTGATCTCGTGCCAGGCACAAAGTACTGTGTGACCAGGCAATGGC
CACTGCCTCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAGGCAAAGGCAGGCATGGTGCGTGAGTCGAAGTCTCCGCACTCGACGCCCAC
CTTCTGCGTTCGCAAGCCGAACGGGAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCAACGGTGCCCGCCCAGACACCCATCCCTCGCAAG
GATGTGTTGCTGAACAACATGGCGGGCTGTGAGCTTTTAAGCGCGCTGGATCTGGTGGATGGATACTACCAGATCCTGATGCGCGAGCGCGACATCCCGC
TCACGGCGGTGAGCACCCCGAACGGCATGCTCTGGGAGTGGCTAGTGATGACACAGGGTCTATCAAATGCCCCAGCGACTTTCAATCGCTTGGTCACACA
GTTGTTTAGACCCTTGCGTGCGTTCACGCAGACGTACTTTGACGATAACTTCGTCCATAGCCGTGCCGAGGAAGGCAAGACGGCTATCGAGGTGCATCTC
GAGCACCTCCGTCGAGTGTTCATGGTCATGAGAGCAAACAAGCTCTATGCCAACATCGACAAGTGCGTCTTTGCGGCACAAGAGATCAAAGTTATCGGCT
GCTTCGTCAGCAGCGTCGACGTTCGAGCCGACCCTGAGAAGGTCAAGGCCATTGCGGCCTGGCCCACACCACGATCCCAAAAGGATTTTCGCAAGTGGTT
GGGCCTCGCCAACTACTTGCACAAGTATAGTGCGGGGTATGCCGGGCTGGCACGACCCCTGTCGGATCTCCTTAAGAAGGATGCCGACTGGCGCTGGGAG
AACCGTCATCAGGATGCATTCAACAGCATCAAGGCGAGCTTGCAGTGCGCGCCGGTCCTGGCCTTGCCGGACGAGACAAAGCCATTCAGCGTTGTCTGCG
ACGCCTCCGACTATGCCATCGGTTGCGCGCTGCTGCAACACGACGCGGACGGGCACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTTAAAGCTGCCGA
GAGGAACTACCCTGTCCATGACAAGGAGCTCCTCGCAATGAAGTATGCCCTTGTCAAGTTCCGGGTACTCCTCCTGGGCTCTGAGCCCTTTGTGATCTAT
ACAGACCACGAGTCCTTGCGGACGGCCACCAACTCTCCGCATCTGTCTCAGAGGATGGCCCGCTGGCTGTCATTCTTCGCGGAATATAACTTCCGCGTCG
AATACAAGCCGGGCAAGCTGAACGTGCTTGCCGACGCGTTATCACGTCGACCCGACTATGAGCTCGCGCACATTAGTCGGGTTACGACAGATCTGTACGA
TCGGATACGCCTGGCATATCGAGATGATGATAATCTCTCTCCCATCGTGCGGTTCCTCACCGCTGGCAAGGAGGTCAAGCCTGCATGGCTAACGCCCCGC
CAACGTGCCCGACTCCGTCGCTATGCGTGGGTCGATGGCCTCCTCCACTACCGCGTGGACCCGGCCAATCCTCCGCGGATAGTCGTCCCCAACGAAGAGG
ATCTGAAGTATGACATCCTTCAGGAGGCGCACGATGTGCCTTCAAGCGGCCACCTTGGCCGCGAAAAGACCTTCTTGTCGGTCTCCCAGGTCTTCTGGTG
GGCCCACATGTACAAGTGGGTCGTCACGTATGTGAAGGCCTGCGAGACATGCCAGCGTGTGAAACCTGCTGGTCATGCCTCGGCTCCTTTGCAGAGCCTG
CCAGTCCCAGAAGACTGCTGGAAGTCGATGAGTCTCGACTTCGTCTTCGGACTGCCGGCTGATGCCCAGGGCAACACCGGCGTCCTGGTGTTTGTCTGCC
GCTTGAGCAAGATGGTACACCTTGCTCCGGTGGCTGACTCCGTCACCGGGGAACAGACTGCAAGGCTGTTCCTGGATGGCGTCTTCCGCTATCATGGCCT
CCCTGAGACTATTATCTCTGACCGTGACCCAAGGTTCACGTCTGCGTTTTGGAAAACGCTGTTCCACTTGCTTGGAACACACTGCTCATGTCCACGGCCG
ACCGCCCGCAAACAGACGGCCAGACGGAGCGCGTCAATCGCGTCCTCGAAGACACTCTACGCAGTGTCTGTGCCGAATCTCCCGGCACATGGTCGGCCAG
TTTGCCGATGGTTGAGTTTGCACTCAACAACGCGGTACACGCGTCCACGGGGTTCTCTCCGTTCTACCTCAACGGGCTCCAGAACCCCCTGGTGCCACTC
ACTCTCCGTGGTGACACCGTGGCTTCGGTCGTAAGTGGGGGAGAGGCTCGGAAAGCTCTATCCTCCCAGGTGTCAGAAGTGACACCGGCTTCCCTAAAGA
AGCAGTTGTCGACTTTTGTCGACAACAGGCTTAATGTGATAAGCCGGGTGCGCGACACAATGGCCGCCGCCCAAGATAAACAAAAGGAGTACTCTGACCG
ACATGGAAGAGGAACTTAAACGTGTTCAAAGTGGACGAGTTAGTACTAGGAACCTACCACTAAACTCGGTCAGTTCCGTGCTCAGCAATAAGCTGAAGCA
CAGGTTTATCGGACCCTTTGAGGTTCTGAGCAGGCATGGTTCCGCCTACACGATCGACTTGCCTAAGTCGATGACAACCCACCCGACGTTTTATGTGGGT
CGTCTGAAGCGCTACCACGACACTCAGGCTTCTGATCCCCCGCAGGAAGCGAAAGGGGATTATGAGGTGGCGAGATCACCACCTCGAACCGAGCGCTCGC
CTCCCGCTGTGGCGACCGCCACGCGGAAGCCGGCACAGGGGACTGGTCGTAGGCGTAAGCCTGCGGCCTCGAAGACGCCCCGCCGTACGGGTAGGAGCCG
TAGTACGGCTGGGAGTACGCATAGGACTGCGTCTCCCGATAGCCCGGATAGCTCGGCCGGTTCTGGAGCTCAGAACGGAGGTGAGCCACCTCGTCGCGAA
GACAGTCGACGTCGTACGACGACACACGACGATCGACCCGGGAGTGGAGATCCCCACACTCCTGACTCAATCGGTCCACGTCCCCACGAAGGAGGGAAAG
AGACCCCGGCTTGCCCGACTGAGCGGCAGCCTGCCCACCAGGGCCGAGACCCAACGCGATCTCCAGAGTGTACACTTGACCACGGAGATCGTGGATCTCC
TGCTGCTGAAGCAGCACGGACTGATCGGGAGATCGCGCCGACGATCTCGGAGCCTCACGCTGTGGCGGAGCCTCGTACGCATA