Transcript Name :
Phyra_g12089
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase13.016PS50878
Integrase, catalytic core9.05PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.020.012580
InsideOutsideTMhelix
1-652
NN-scoreoddsWeighted Score
0.5645.6830.011
PositionContextScore
114VAQRVRR|VA0.52
TypeScore
cytoplasmic47.8
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        4035 bases(100 bases per row)
ATGATCGAGCCGAAGACGCCGCCGATCACCGAGTCGGAGATACCAGATGACGACGAAGTCTGTTACCATGAAGGAGGCGACTTGTTCGCGGAAGACGTGG
AAAAGCAGATGGCTGTCTTGCCTGAGGTAGCAACCACTACCGACGAAGTCATGATCGAAGACATTCAGGTGGGAGACCCTGATTTCAACACCCCTGAGGA
GGTCGATCGTCTACGACAAATCATCTGGCGCCGGCGTCACCTACTGATCGGAAAGGGAAACGCGTTACCCCCGGCGGCTGTAGGCGCGGTGTGCGACATC
GACGTTGGGGGAGCAACTCCTGTCGCCCAACGCGTTCGCCGGGTCGCCCCACAGTTTCGCGAGAAGCTGTCGGACCTGATCAAGAGTTTGCTGTCTGCGG
AGATGATCGTTCCGTCAACCTCGCCGTGGGCATCACCGATCGTGATCATCATCAAGAAGAACGGTGTTGACATCCGACTCTGTATCGATTACAGGCTGGT
GAACGGATTGACACGACTGATGGTATATCCCATGCCGATGATCAACGATCTCTTGGAAGATTTGGACAAGGTGCTCTGGTACTGCTCCCTCGATATGGCC
AGTGGTTTCTGGGTGGTGTCAATGACTGAGCGAGCTCGGAAGATCTCTGCCTTTGTCACGCCATTCGGACTTTTCGAGTGGACGCGCATGCCTTTTGGGC
TGAAGAACGCCCCACAGATTTATCAGAGACTGATCGACAACGCGCTGTATGGACATCTCCGAATCCGCGCCGGTCACGACCCGTCGAAGCCGATCGACGT
GTTCGAGGCAGGGGAACCAGAGCCGGAACTGAAGCCGTCCGTGCTGGGAAGATGGTCGTACATCGACGACATTCTCGTTACGGCGACCACTAGGGATACT
TTATGTGAAAAGGTTGAGAGGTTGTTGGACGCTTGCGAACGGTGGAATCTGTCGATCAGCGTTGTCAAGAGCTTCTGGGGCCAGCGCAAGGTGGGTTACT
TGGGCCATCAGGTGTCTGCTGATGGTTTGGAAGCTCACCCGAAAGACTTTGAGGCGCTGAGTAATCTCCCCTTCCCGCTGACGCTGCGATCGATGCAGGC
TTTTCTCGGAAGTTTGAACTACTACAGTCGCTTCATTGAAGACTTCGTGATCTATGCCGCCGGCTTGTACGAGCTGCGCGAAGCGGACTTTCATGAGATC
AGCCGCCTAGAGAGGATCAACCCTGACCAACAAATGACTGGGGGCGACGAACCACAGATTCCGGACGCTGATCGCTGGACCCGAGCGAAGATTGCATTCA
CAATGTTGAAGGCCAAAATCGTGTCCACACCGATCCTGAAGCATTTCGATCCCGATCGCACTCCAGTGATCGTGGTCTACGCGAGTCAGTGGGCGATATC
TGCGGCACTTGTGCAAGAGCATGATGGCGTGTACTGGCCAGTAACTTTCACCAGTTGTACTTTGAAGTCCAACTAGCTCAACTACGGAATCGTCGACAAG
GAAGTCTTGGCGCTTTTACGGATGCTGGACGTGAATTACACCTTGCTGACGACGAGATCGATCTTGGTGTTGTCCAGGCACTCGACGTTGGCTTGGCTAG
TCAACTCAGCCGGTTTCCAGGGAAGACTCGGCAACTGGGCTGCGCTGCTCTCAGAGTGGACGTTAGAGATCCGGAAATGCACGAAAGGGGAAGATGAAAT
CCTGGGCGTGACTGCAGCAAGCATCACACCTCGCGCTGAAGTAGACGAAGCGCTGATCGCGATTGCGCCGGTGAAACAGCCTCGACAAACAATCCTCATG
CCACCCCCTACGGTTGAAGCGGACGAGAATTTGTTAGTCGCGAGCTTCGATGGATCAGCACGTGTTAAACGTAGCGGTGGGGCTTACAGCGCGATCATAT
GGAAGCTCCCCGAGTGGACGATTTTGTTAGCCGCGTCGGAGTACATGCCCGATCTGACCGTGAACGAAGCTGAGTACCGCGGGTTGTTGCTGTGTTATGA
TCTGCTGTCGACTTTGGACCGGGGGCGGATCGTGATCTGCGGTGATTCCAACCTGGTGATCCGCCAGATGCGTGGTGAGATCGCGTGTAAGGCGACAGGC
CTGTTGCTGTTGCACCAAAAGGCAATGGAACGGCTCAGATCGTGGCCGAAACACGAGTTCCTGCACATGAAGCGAGACTGGAATCAGAGCGCAGACAAGT
TAGCGAGCGCCGCTCTCCAACGAGAAGCAGGAACTGTGATTACCTCAGAGGATGATCGGCAGGACTTGGTCACGCTTAACCGTCTGGATGAGCTTCTCAA
GCCGAAGGATGACGACGGTATTGTCCGTGTGTCCGCGGTGACTAGATCAACGCGGCGTCGGCGATCGTCTCCCTAGGCTCTGCAGGAAACGATCATTCAG
CGCATGCGAAGTGAGCGAGTTGTCCAAGCCCAGAATGAGGAAGAATGGATCACCGACCTAAAGGCGTACCTGAAAGGAGACGTCGGTAGCTTGACCGCGA
AGGAAGCCAAGTCGTGTGCTAAGATCGCGGACGAGTACGAGCTGGATGAGAGCGACTTGTTGCTCTATTGTCCATCATCCATGAAGCAGGACGAGGATCG
GGATGTTATCGCAAAGTTGGTGGTCCCAGAGACTCTGCAGCAAGATTTCTTACATCACTATCATGCGAGTCTGGAAGGAGGGCATCAGGGGATCGGAAGA
ACGTACCGACGAATCCGATCGCATTTTCACTGGAGAGGTCTGTACCGAAGTGTCCAACGCTACATGGGAGAGTGCACAGACTGTGAGACAGGGAAAGGGC
GACCCTTCGTGAGAGGAGAGTCCCCTGGAAACTTGCAAGCGACGTACCCGTTCCAGATTGTCGCGATGGATCACATTCCGTCGTTGCCCAAGTCCTTCAA
GGGCAACACGGAGCTACTGATCTGGGTAGACCTGTTCTCGGGATATGTGATCGCGAAAGCAAGCGCGTCAAGGACGGCCCAGACGATCGCGGAGAATTAT
GAAGAGTGTGTATTCCGCTGTTTTGGAGCCAGTGAAGCCATTCGGCACGACAGAGAACCCGGTTTTATGTCTGATTTCTTCCGTGCATTCAGCCGGATCG
TGGGACAAAAACAGAGGGCCACGATGGCGTACCGGCCCCAGGCAAACGGAACAGCCGAGCGTATGGTGCAGACGTTGACTCGAGCGTTGAAGATGTACGT
CGCAGACGTTAACCAACAGGACTGGGACGAGTACGCAGAACGCCTCACATTCGCAATCAACACGGCCCACGATCGTGTGCGTGGAGACACACCGTTCTAT
CTGATCCACGGATGGGACCCACGATCCACGTTGGAAGCGGCGCTACCCGTCGGGAGCACGCGCCGACGTGATCGCGAGCCAAGACGATGGCGATTCCACA
TGCAAAGTCAATATCGACGCGCAAGGGAGCAGGTAAATGAGCGGCTCCGGGAAGCGATCCAGTCGCGAGCCGACGAGCACAACCAGAACGTCCGATCCCA
GGAGATTGAGGCTGGTGCACAAGTCTGGCTGTATCTGGACCGGGTGAAGGAAGGCTACGCGAGAAAACTGGCGCATATGTGGCACGGCCCGTTCCGGGTA
GTCGAGATGGTAGGTAATCACGCAGCGAGACTGGAGACTGCTGGCACGGAGTACCGCTTATTCCGATCGTCCACGTGTCCAAGCTCAAGCTGGTGCGAAG
TTTTCCCGATCGCCCTACGTTGGCACTTACCGTGGTTGAAGGCGATCGTTTCGATTTTGACGAAGCAATCCTGCCAGAAGATAGTTGGGAACGCAGCCTT
GGCGAAGACGAATACGAGGTTGACAGATTGTGGATGTGCGATCAGGGCGGCGTACGCGCTATGGGCGAGTTCATCGAGAGTTCCAAGTGTACTGGAAGGG
CTACGAAGATCCATCATGGGTCGACGAGGCCGACCTCAACTGCGGAGCATTGTTGCGTGAGTATGAACGTGAGGTAACTAACCGCAACCGATTCGGAGTC
ATGCAGTCGCATGAGGCGGAGGAGGAGGGCTCGTA