Transcript Name :
Phyra_g12117
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0490.09917
InsideOutsideTMhelix
1-140
NN-scoreoddsWeighted Score
0.6161.2550.003
*** None ***
TypeScore
cytoplasmic56.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        4668 bases(100 bases per row)
TGCTAAAGTATCGGATACATAAAGACCCAGTGAAGGTCGCCATGTTGCCTGGCATGCTGGACAAGCTCACGGTGATCGAAAAAACCAAGATCGAGAAGCA
GGGCATCGGATGGGTCAAGAACGCTATTAACGAGCGGTGTGAGAAAGACAACATCATCTACGCAAGCACTAAGTGGGTATCATTCTGGAAATACTTCGAG
CACACATGGCTGACCGAAGTAGTGGAATGTTCATGACTTTAGCAATGGCTTTGTCGCGCGCTCTGTAAGCCACGACCCAGACGAGCTGCTATGCAAGGTG
CAGACTGGCAAGTTTACAAGTAGCTGCATCATCTACGACAACGGAATACCTACCGATGTTTTTTTTCCTCGGGGGTTGCGCGTATTCAAACTGTCTTCAC
TATGTCACAACGTTTGAGATGACCAAAGTGATGCATAAAGGCCGGCATTAAGTTCCCGAATCGGAATTCGCTACAGAGTGGAGCAAGCTTTTGACATTCT
TAAAGGAAGGTTTCGTATTCTTCAGAGTGAGATTCCCCGCGCTGTGATGACCTTCGAATTCAACCCAAAGTTGATTTTTGTACTCTGTTTGCTACGCAAC
TTCATCATTATAGAAAGCGATTTGTACTACAACCAGTTTGATGTGCAGCGTGAAATTGCAGGTAACCCATATTAGGCACTTCGAAGGGTTTCTGATTAAT
CTGTGGGGACGTCGCGCAATGTCTGAATTTGGTTCAGCAACAACAAAAGAAGAGTTAATCACGCTGTCCAAGCCGCTCCCGTAGCAGATCCTGGTTTTCT
CTCTCTAACGTACTTGGTACTCGCGACACTCCTGGCGCTCATAAACGCGTTGGTGCTGAGCGGCACGGCGATCCTCCAGTATTTCATCTAATTTGTTTAC
CAAAGAATCTGTCTGTACCTAGACCAAGTTCATAAGGAAACGCTGGTCATTGCTGGGTTGGGATATTTACTTTCGTTTCTTCTGCCCTGTTATTGAAGGC
GATTTCTGTGACATAGGTGCATGCTTGTACGGGATCATGATAGAGGCCGCGTTTATGGATACGTTTTTCTGTGTGTCGAACGCTCTATCTGGTGTCAGGT
CTGCTATCTGGAGGAAAAATGACCTTTCTTGATGGTGCAAGCGAGGCGTAAATTATGCGCTTGACAATCAAGCAATGGAAATTGCTACCTAACATCCTTG
CCTCACGAAGCAATGAGAACCCTGGCCGGTTTTGAACCCAGGCGCGGTGAGGTTTGCTTCCCAGATCTGCTGTCGAGCTGCCGCAGACGCTGCAACCGCA
AATTTCCCCTGGTGTGGAGAGTTGGCAGTCGAAATTTGCTAGTGAAGAGTGCGGACAATCTATAGCAGGAGGTGGCCTCGCCGAATTGTTGGTGTATCTG
TGCAAAGTAATCCTGCAGAATGCAGTTATACTAAAGAACGAACTACCGAGTCACCCAATATGGCGCCATTCAGTTTTCCAGTGTGACGAATTTTACCAGT
TCAAGCGTGAGTTGAACGAGTTACTTGGTACTATAGTGGCCCCGACAGAACGGCAGCTGGAGAAAGCTATGCCTGTCGCGTCAAAACAACACTTGATGGT
ATGCATCAGGGTCTGAAAATGTCGGTTGAGAGAATTCGGAACAGTTTGGGGCGTGTCGGCGGAACTTAACCGACATTGCTAAAGTGTTGTCTCCATTTAC
TGACGGGACGGCACTGCTGCTAAGATCGTTAGGGGTGATGTGTCTGCAAGACCAACCGCAGTAATACCATTAGCACAAGATATAACGAGACCATCGTACG
AAATGGGGCATGAAGGCGTGGTTCCGTGGCTCCGTGTCGACGGAGTCGCAATGTTATGACTGTCCGAGAGTTGTGGAATGAATGGGAGAAAGGTCTTTCA
GGCGGACGGTTCGTAAAGACATTGGAAAAGAACTTTGGAGCTAAATTGTGTGGCAACGGAGAAGGCGGTTCTTCAATCACTGTCAAAAACCATCAACGCT
GTGACGGTCACAACAGAATCAGTACTGAACAGCGGATCCATTGATAGCCACAAGGTTGATGACGTCGCAGTAGAGCATGTGGACGCTGTCAGAAATGCAC
ACAGTAAAATCGCTGAACTGGTTGTCGCTCAATGCAGATGCAGAAGCAAGGGAGCTAGGGAGCTAGGGATTAATGCACTCATTTACCCCGTACGACCCAG
CAGTACAGCATCGCGGGCACTGCCATTCAGATAGCTCCGATAACCAATTCTTGAGATATATTGAAAGCTGAATGAAGAATGGAAACGCTCCTATTTCGCC
CAGCATTTTTAATTTGATCGACCGTCTGTTAGGCCACGGAATGGGCGAGAACCGGTCGATCGAAGACGCAACAGCAGTGTCACGAGATGTTGCGGGCTGT
ATGCAATCTGCAGCAACGATGTGTGATGTTGGCTCAGGCTCTTCGTCGACGGTAGCGTCAAATTCGCCGGTACCAGGAGTTTCCGTAGAGATCGATAAAT
AAGCAGCAAAAAAAAAAACACCGTTCCTACACGCGCCGTTCACGCCGTTCTTTTATAGCCTCTTCAACTCCCGGTAGCGATAGCTACTGTGCAGCAAACA
AGGCTAACCCTGACCAATCGTATCGACCATTTTTTGAGTCTCGAAATGCATTCTTTCTCTTTTGGTGGCGTCCTTTCCGGGACTTCTTCACATGATAGCC
GTGCACGCGTTGCTTGGGTAGGTGAGGTCGTTCGCGTTGCTGTACATAGGGCTCAACTGCGAGAAACGCATCCGCTACATCAGCTGGTGCTAGAGAGTTG
TCGTTGGTACTAACACCCGTATCTGCGACAGCCGGTACCACCACTCCACACGCAGAGACAGATCTATTGAAGGCGACGTCACTTCCATTGTTTTTGGTGT
TATCACTATATTCATCATTGGACGGCTCGTCCAAGCTGTACAGCAGCCTATCCATGCGTACAGCTTGTGCACAGCTCGCACGCTGTCTTCGACAACGATG
CACAGACTTGTGTTGAGCCGTCCAGCAATAGTACGCCCGCTAACTTCGCTCTGGATGAACGTAAAAAGTTGTCAGCTTCCTCTACCACGAGCCATTCATG
TAGCGTGGTAAAGCCGATTCACCTCGTACCTTAGTGCAACACGCACTAATGAATATATACAGGCTGACCACTCCACAGAGTGGTCCACATTCATAGCAAA
GAGATATGACTGGTAGAAAGCAACATCTTTCTACCAATGAGAGTCATTCATTAGATAGGGTTCTGCCATCCATCCAATGGCAGAACCTCTCATTAGAAAT
ATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGTGG
ATACAAGTAGACTGGATCTAAGGTAAATACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTAAAGTAGTGGGTCTAAGCAGACCCATTACAC
CTGGTAGCACTTTGTAGCCCGTCCAACGACCGACTAAGAACACGTTCGTATGGAATACGAACGCGGGGTTGAGAACGCACCCTCGGACAGTAACATGTTC
GTGGGTAGCCCAAACACGTCTGAAACGCATGTTGCGCGTGCAGACTGCCCCCACCTATCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCGACGGTCA
TTGGAGAAGCAGCGGTAGCAACGATGTTGTGTACGCTATCACCGACGGAGCAACACGATGTTGTTCTGGGTTTCATCGTGAAGGAGCAGCGTGAAACCAC
TGCTCGAGCTTCGGTGTCGCCTTCGGCCACACCGCGCGTGGAGTCATTGACACTCCACGTAAGCAGCTATGTTGGAAGAGAGGGGGAACCTCTCTTCCGT
TGGCTTGTCGAGGCCGACACTGTCATTACTGCTCGACGTATCGTCGACCTGTTGTCGAGGGTTGCGTTCGCCATGTCATGTCTTGACGGACGAGCAAGGA
GTTGGGCGTACGAACGCCGACTCACAGACCCTACGTGCTTCAGCGCGTACGAGGTGTTCAAGGAGGAGCTCAAACAAGCGTTTGAGCCCCCGCAGAACGA
GTTCCGATCGAGGGCAGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGGACAAAGAGCACGATACTTGGTCTCGAACATCGTGACC
AACCCGATCGACGAGGCGACAAAGGTCGTCACGTTCATGAAAGGCCTTAGAGATGGGCCTATGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCG
AGGCTGCAATTGGGCTCGCAATACAAGAAGAGTTTAGCCTGCGACAGGCTAAACTGCATGTGAGCGTCCCGCGGCTGATGCCACGACCGGTGGTAAGGCC
GTCGGGAGGACCGGAACCAATTAACCTCTCGGGTGCGACGGCTGCTGGTTCCCAGCAGCGTCATGGATCAACAAATGTTCATTGTTTCCGCTGCGGACAC
ATCGGTCACTACGCCCGCGAGGGCACAGCACCTGTGCGCGCGACCAGGAGCCGCGTGGCGATACTGGGTATCGTCACAGGCTAACAAAACACTAGAGGGA
CCAGCAGGACGCCCGGCGCCCTGCTGGTGATGCGGTCGAGCGTGTCGACATTGGACACGCTGTATTGA