Transcript Name :
Phyra_g12115
Orientation:
(+)
Number of Exons:
2
Description :
PREDICTED: uncharacterized protein LOC101063318, partial
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.060.0736
InsideOutsideTMhelix
1-295
*** None ***
PositionContextScore
13SWKRFAR|DL0.694
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        947 bases(100 bases per row)
ATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGACCTGCACGATGGACGCATCGAGCAGATCTGCATCTTCTCGGATGTCGAGAGGATGACGT
GTGCAGCGGAAGAGCTGAAGCAGCTCATCACTGAGGGCGCGGAGACCCTCAGCGCGAAGTCGAAGAAGGAACGGTTCGACGAGCAAGGCTGGGACTCGCT
CAAATCGAGTCCCTTTTACAATGTCTTGCGTGAGTACAAGGATGTACTCCCGGGCGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAG
ATTGATCTCGTGCCGGGAGCAAAGTATTGCGTTACGCGACAGTGACCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAACGTCGTCGCA
AGGCAGGACAAGGGTGGACATCTAAGTCCCCGCACAGCGCGCCCACGTTATGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCTTACAATAA
GCTAAACGATGCGACGGTACCGGTGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTATTATCTTCAGTACTCTTGATCTG
AGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCGC
AGGGTCTGAAGAACGCCCCAGCGACATTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGATTTCGGACCGAGCTATTTCGATGATGTGTTCAT
TCACAGCCACGGTCACGACCTTTGCATCAGTGTGAATCCGATCGCGAAATTGGACGCGGCACACACAACGTGGAATGGGCGATCTTGGTCGGCTAACGCC
AAGATCGCCTCAGCCAAGCCCTGCTTGACTGCTTCAAATGCCTGCTG