Transcript Name :
Phyra_g12108
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_513613
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0330.07115
InsideOutsideTMhelix
1-201
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        701 bases(100 bases per row)
ATGGTATCACGAGGCTCGTCAATCCACCACACGCGGCGCACCAACAACCCGTTCATGACCACGAGCTCTGGGATCGTGGGCATTGACCTTAATGAAAAGG
TGACCTTCGACGCCCCTCGGCTCCGCACCAGTTCTAGCAACAACCAGATTGGCACTGGCCAGCCACGCTCTGCGAACGCTTTGACCGAGTTCATGTACCA
AACGACGTCGGGGGCTCTTGGTGAAGGCACCCGCGCGCAGGAACGCCTGAGACTGAGCCAGCGGATGGATAAACTCACCGTACACAAAGGTGCGTGCTGC
AGCGGCTTCACACTCGATCCAACCTGGAACTGCTAGGGATACTAACGTGATACCTGCTACCTGCTCGTTTTGTGATGTTGAATAGAGGTGGAAGCGTCTG
GCCTCGTCACCATCCGACAGGTAGACGTAGCAGCACCAGAAGACTTTGCAGTCCGCCCAGAGGATATCATGCCCAAGGCCGTCGACATCAAGTTGATCAC
TGAAGCTCGAGGTGAGCATCCTTTGTACGCCACCAGCAATCGAGAAATCGGCGCCGACAAGGCACAGCTGAAGGTCGAGATCGAGCGGCTCGGCCGACCA
AACACTTTCACCACGTCGTTCAACGGCTTCCGATACCGCGACTTCGGGCTCAACACTGCCGTGACCAAGTCCCGCATCTGCGACCAGCTCGACTACTCTT
G