Transcript Name :
Phyra_g12112
Orientation:
(-)
Number of Exons:
1
Description :
flavodoxin/amb allergen/pectate lyase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Pectate lyase/Amb allergen0.0000013SM00656
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pectate lyase/Amb allergenIPR002022
Y-scoreD-scoreY-pos
0.8530.89322
InsideOutsideTMhelix
1-400
NN-scoreoddsWeighted Score
0.6661.0580.002
*** None ***
TypeScore
mitochondrial34.8
GO
*** None ***
*** None ***
*** None ***
Sequence
        1202 bases(100 bases per row)
TGCAGTTCTTCCGTCCCATTCTCATTGTGGTGGTGGCTATCGTGGTCCAGGCCACGGACGCCTTCACGGTCGGATCGGCCACCGGTCTCGCTGCCGGAAC
CACAGGCGGAGGCAGCGCCACCCCCGTGTACCCCACCACGACGGCGCAGCTCGTCGCGTACCTAAAGGACGCCGTGCCCCGTGTCATCGTGCTCAACAAG
ACGTTCGACTTCCGCGGCACGGAGGGCACGACGACCGAAGCTGGTTGCCGCCCAGACTACACCCGGGAGTGTATCGCCAAGAACAATGGCTACAAGAGCC
AGGATGTCATCCTGCAGAGCGGTGGCATGTCCAACACGGGTGGCTGCTCGGACGGCACCAGCGTGACGGTCACGTACGACAACGCAGCCATCACCCCACT
CACGGTGACTGGCAGCAAGACCATCCGCGGCATTGGCACGAGCGGTGTCATCATGGGCAAGGGTCTGTGGCTGAACGGCGACAATATCATCGTGCAAAAC
ATCCACATCACGGAGCTCAACCGCCACTTGGTGTGGGGTGGCGACGCCTTCTACATGCAGGGCAACAACGGCGGCTCGACGGCCATGAACAAGATCTGGC
TGGACCACATCAAGGTCTCCCACGTCGGCCGTCAGTTCTTGACGACGAACGCCGCCAGTGTGTCCACGATGACCATCAGCAACTCGGACTTCGACGGCCG
CACGGACTACTCGGCTACGTGTGACGGTCGCCACTACTGGTCCTTCATCTTCTACGGCAAGAACACCCGCTTCAGCATGCTCAACAACTACGTTCATTCA
ACATCGGGACGCTCGCCCAAGATCGGTGGCGACAGCAGCGCCAACGTCGTCGCGCACATCGCCAACAACTACTGGGCGGACAACTCGGGCCACTCGTTCG
AGATCGGCGTCAACGCATGGGTGCTCGCCGAGGGCAACTACTTCCAGGACACGACGCTGCCGCTGCTGACCGGCTCGGATGGCGCCCTCTACGCCGCCAC
CGCCACCACCGAGTGCAACAGCTACCTCGGTCGCTCCTGCGCCGCCAACGTGGTAGACAACAGCGGAGCGTTTCAGTCCCGCAACGGTGCGACGGCTCTA
TCCACGGCAAAGTCGTACTCGGCCATCTCCAGCTACAGTCCGAGCGCGGCGAAGAAGCACAGCAAGACCACCAACAACTTCGGCATCGGCGTGCTCAACT
AA