Transcript Name :
Phyra_g12102
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_462099
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.050.04527
InsideOutsideTMhelix
1-460
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1502 bases(100 bases per row)
ATGGAGACCGTCGAGGCCCAGAAGCTGCTGGCGGAGCTCCACGCGGCGGAGGAGGAGCACGCGCGCGCTCTCGCAGCCGCCAACCAAGTGCGCGACACAT
TGGACCGTACCCGGAAGGAGTACGAGGATGCGCGCACCGCGGAGAAGGCTGGCGAGGACGAGCTGGCCAAGGCAGCGGAGGCGCTGGCGCTTGGACTGCA
GAGTCTCGACGTGGCTGCCAAGGAGGACGCGCCGTACCCGATAATCGCAGACTCGTTGGTGGAATACCACGCCAACATCGGCTGCTACCAGTGTTATTTG
TTCCTAGACAGCCACAAAGACGGCGAGAAGCTGGAGGATGCGACGTCGGAGCTGGACGTCAAGAAGCTCAGCGTTCGAGTGGAATTCCCACGTGTAGAAC
TCACATACAGAGTCAGTGATAGTGCAAAGGACGCTACAATTGTCTGGTGCACGGAGATCGAGCGGAACGTGGACGTCTCGCAGTGTGTGGTGGAAGAGAA
GGGAGATCACTGGTACCTGCGACTGCCGATCTGGCCTAGTGACAAGCAGCCGCTGGGCGGGTTCTCGTCATTTACGCAGGTGTCTCCTGTCGAGCTCCGA
CCGGAGAGTTACGTGTCTGTCAGTTGTCGAGGATGCAATGAATTGCTGCTTGGTGGAGAGGAGATCGCGGGTATTGAGAAGGTTTTGCCGCTGCCATCCG
CCAACTGGATGGACATGTTTGACTTCTGGGGAGCTGGTATTGGCGCCTTTGAGCATATTCCGAGGGATGATATCCATGCCCAGCGACGGCGTGTGCTTGT
TGGCGAGTCGTATGTGCTTCTACACGCTAGTGATTTAATAGCTGGCGCGACGGTGTCCGATCATGGGGACAAGGCGGCGGTCGCACCCGGAGATAATGCG
AAGGAGGAGCGCGAGTGGGTGCCATTGGTATGTACTGCGTGCTCAGAGCGGGTCGGCTTGTGCAGTGTGGAGCAGCCGGATACTGTCCGTCTGCACAAAC
ATTTGATCAGTGCCCATTCGTGCTTTACAGCGAAGACTGATGCTGAAGGAAACTGCAGCAAGCAAGAGCTAGAGGAGGATGTGTTCGGCAAGTATACCAT
CGACAGCATTCTAAGCGCCAAGCTACTGGAGATGGCGGATTCAGACGGCATTTTCCGGTTCATCTTGACGTCGTCGGGAGGCAAGCACGACCACGATCTG
CATTGTGGTGCTGCTCCAGCTTCACCCGCTGACGCGCCTTCCACAGAGCTGCAGCTGCAGCTATTGAGCTGGGAAACGATGATCAAGCGAAAAGACTCCA
ACAAGTTTAGTCGCGTGCTGAAGGTGCTGTATGCACCTCGTCAACCGATGCCAGCGATTCCGGGTCTATTACCTTCGCAGGAAGTAACACTGCCGCCAGC
AATGTGCCTGGCCATCGCCCAGCGACTTGAATCCAGCTCTACGTTGCTGCCATCGTCGCTGCGCGCGTTCAACCGGATGCACGTTGGCTACCTCTTCGCT
TG