Transcript Name :
Phyra_g12103
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_514765
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
HEAT, type 210.264PS50077
HmmSmart predictionP-Valprediction_id
PBS lyase HEAT-like repeat640SM00567
PBS lyase HEAT-like repeat0.01SM00567
PBS lyase HEAT-like repeat0.0000013SM00567
PBS lyase HEAT-like repeat1.5SM00567
PBS lyase HEAT-like repeat0.00068SM00567
PBS lyase HEAT-like repeat0.00000013SM00567
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
HEAT, type 2IPR021133
PBS lyase HEAT-like repeatIPR004155
Y-scoreD-scoreY-pos
0.0310.03244
InsideOutsideTMhelix
1-312
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        938 bases(100 bases per row)
TGCCATCGCACTCGTCCGTGACCGAGACAATCGCGTCCCAGCCCGTACCCGACACGACGCCAAGCTTCGAGAGGCTGCGTGATGCGCTGCTGGACCTGTC
GGAGCCCGTCGGCAAGCGCACGCGCGCCATCTTCTACCTGCGCTCGCGTGGCGGCCTCGAGGACCTGCAGGTGCTGTTACAAGCGCTGTTGAACCGCGAG
GATTCGGAGCTCATGCGCCACGAACTGGCCTACGTGATCGGCCAGTTTCAGCGGGAGGAAGCCTGCGACACGCTGCACCGCGTGCTGTCGGACGAGCTCG
ACGACGGAATGGTGCGTCATGAGGCGGCGGAGGCGCTGGGCGCCATCGGCGCGGCCCAGTCGCTGCCCATCCTCGAGCAGTTCAGCACTGACTCGGCGCC
CGAGGTCTCGGACACTTGCAAGCTGGCAGTAGACCTGGTCAAGTACAAGTTGGCTAAGGCCCAGGGAAAGGTCGCCGAGGGAGAGGTAGACCGCAACCCG
TACCTGTCCGAGGACCCGGCTCCTGCCGCCGAGAAGGACGTGACCACCGCTGAGCTGCGCAAAGTGCTGCTGGACCACGACGGCGACATGTTCGCCAAGT
ACCGCGCCATGTTCTCGCTGCGGAACCGCAACACGGAGGAGGCGGCGCTGGCGCTGGCCGAGGCCTTCAGCGACCCGAACGCACTCTTCAAGCACGAGGT
GGCGTACGTCATGGGTCAGATGGAGAACCCCGTGCTCGTGCCGGCGCTCAAGAAGGTGCTGCTGGATGACAGTGAGCACCGCATGGTGCGGCACGAGGCG
GCCGAGGCGCTGGGGGCCATTGGCACGACCGAGTGCGAGGACATCCTCAAGCAGTACCTCAAGGATGACGTCCAGGTCGTGCGGGAGAGCTGCGAGGTGG
CACTCGACATCATGGACTACTGGGCGCCCAGCAAATAA