Transcript Name :
Phyra_g12090
Orientation:
(-)
Number of Exons:
9
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0190.02610
InsideOutsideTMhelix
1-740
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        13898 bases(100 bases per row)
TGGTGCGCGTGCCCGGATCTTCTGGTGACTCACAGGGATTTCACCGTGAGTCCACCGAAGAAGATGTCAAGATCAAGACGGAACCAGGGAACGAGACGTC
GACGGAAGATGGATCGCCGCCGACGGCGCTGAAAGTGCCAGGATCATCTGATCGCGAGAGTGCTGGGAGGAGCTCTGACGATGTGATAGAGGAAGGTTCA
GCGATGGACCTAGAAGAAAAGCCTCCCCCTCCCCTCCCCAGGACCCCCGCGGATCGCGATGCGAATCGCGATCCGCCGGACGAAGGTCCGACGGTGAAAA
CCGAAGGACCTTCATCCAAAACCACTCCTCCAGCCTCGTACCCAACCGCGAAGAAGAACAAGTCAAAGACCTCACGCAAGAAGCTGAAGGCACCGGAGTC
TGAAGCCGAAGACCAGGAGGATCGCAACACGTGGACGGATGAGCAACTGGAGTCTGCCTTCTTCTACAAGGACCTGTACAAGTTCCTGCATGAAGATCCT
GTAATGAAGATCGTGCGTCCCAAGCCAATCGGAGAACTTCAAGGTCCGGTGAAGGCGCCAAAGGAGGTGACCAACTAGCTTGACGCAGTCAAACTCCTGA
TGCGAATGTTGAAGGGAGCAGGAATCGTACTTGGTTCGTTCAACGCGAACGAATTGTTCGACCTGGCGTTGCCGGTCATCAGGGAAGCTACGTTAAACCT
GTTCACGAAGCTGACGCCCCTTGTCGGAAGCGTCGTCCCGGTTCAACGTACAAGACCAACACCGACTCGCAGCCAAACTGGATCGTCACAATATGCCTCA
GCCACATCGGAAGCAGGATCGGACAGCTCGATCAAGCTGCAGCGGATGACGCTTGGACCAGCTGCAGCGGATGACGCTTGGACCGACTGGAGCAACCATG
CTACAATCGCGAAAAGAGCGATCGGAAGCCAAGCCGACGGAGATCGTACCACACGATCCAGTCCAAGCGCCGCCCGAACGCATGCAATCATTCTTCAATG
CAGCGATGGAACGTTTCCTGAAGGAACAGCAAACGACCGTGACACCGCCAGCTGCTGTCCAGAACAGTCCAACCGGAGCTCAAGACGTGGACATGGAGTC
CGTGGGATCGAACCGCCCGGATCATTCGCATCCAAGTGAGTACGATCCGGACGACTTGAACGTCGGTGTTACTCCCCGTGCCGCAGTCGCTTCTGCTGGA
GCCACGAGCGGCGGAGCACTCTCTGCCACCCGCATCAGGGTTTCTGCGATCTCGGAACTAAAGGAATTCTCCGGGAAGGATAACGACGAAGATCGCGCTA
GAAGCTGGTTCAGCAAACTGAAGTCTGCTTTCACTCGTGATCAAGCTCCAGACGGCGAGAAGTGTCTGGTGTTTGGAGATTTGCTCACTGGTCCAGCGCG
CAACTGGTACCGACAGCTAAGTCGAACGACGCGTGGCAACTGGAAGGAGCTATCCAAGAACTTCCAGACCCAATACTGCGGGCGTGGTGTATCTGTCGCG
AGACAGTATTACCATGCGCGGAAGAGATCGGACGAATCGCCGTTGGAATATCTGCACCGTTTGAATGTCGCGGGTTTGAGAGCTCAGCTCTCGATCAAGG
ATGGATCGATCGAGACCCGCCGTGAGCATGTCGATCACTTTATCGAAACGCTCGACGATCGCGATCTGGCCAGCCAACTGGCGCTGCTCAGAATCCCGGA
TGCAGACACTCTCGAAGAAACACTGCGATCTCGACAACGCGCGAAGGCGAGGCAGGGAAAAACGGTGTATGGATCCATCAAACCCAAGCAGAAGACGCCA
ACTGGGATCACCCCATCCGCCAACGCTCGCGCGGTTCGTACAGTCCGTACAACGGCCAACTCGAGTGAGTCCGAACCGGAAACCAGCGGATCGGAAGGAG
AAGGCGATCTGCGCAAGGTGTACTTCGCGGCAACGCCTGACCAGCCGACTCGATTGCGATCGGATCAAGATCAACGTCGTCTTAGTCGAGACTCCAACGA
CCGTCGCCTCGATCGTCCCACCGGACTACCCGAAGGAGACATCCCGCGGAAGCCATGTTCCCACTGTGGATCGTCGAAGCACACCGATCTTGGTTGCTGG
AAGCGTCTGACGTGCGAGAAGTGCGGCAAGAAGGGTCACCCTACTGACCGCTGCCTCTTCGTCTGCAAGGCCTGCGGCGAGATCCACGGGGCTGGAGAGT
GCCCGATGGAAGAGTTTTACAACTTGATCCGCCAATGGTATAACCCGAACAAGCACGGTGGAATGCTCCCGCAAGCGGCCGAAAAGATGTTAAACTAGAT
CGCTCGCCGGGTTTGAATCCGGTACGAGACGAGCGTTCTCAGTTCTGCATCTATGCATATGTCGAGAAACAGTCGAAGTCAGAGGTGAGTAAGCTGATTC
GGCCGACTGACAATACATGTGATCTTCATGACAAGCGTACCGTGGCGATCTCCAGCCTGCATCAGATCGACGAGTATTCGCGATCAGAAGTGACAATGGC
TTTGGATCTTCTGCACGGAGAGTCACGAGGATATTGGAAGTACCATGTGCCAGACAAGAAGTTTCGGCAGGCGAAAGCCATGGGGAAGATCAACAACGAA
AGAGCCACATTGCTGTTTGACAGCGGCGCCGAGGTGTCCATTCTGGATGCCGCCTTTGCTCGTAAGGTTGGGTGCTACATAGACAACAGTCAAGAGTTGG
AATGTGAAGGAGTTGGTAAGAATCCCTATATGGCGGATGGGCGTACCAGAATCAAGATCACGCTCGCTGGATCACTGGTGTACTACTTCGACGCGTGGGT
TGGTCCGCCCACAGGCGGCCAAGACCTGATTCTGGGGATGGACTTCATGGTGCCAGCTGGCATCCGCCTCGATCTGGCTGACGGTTCGATAAATCTTCCG
GACGAGGTGCGGATTCAGATAGCCGGTCGACGTCAGCTCTACGGTGAGAAAGTTACGCAGGTCAAGCTCGGAGAGCATTGCCAGCTGGAGGTCGGAGCGT
CGGTCGAAGTCCGAAAGGGTTTCATCCTGTCGAGCCACCGGAGGTTGTGGGTTACCCGAGGGGAACGATGGGTACCGAGTTTAGTCGCCGGATTAGGGAA
AACGCGCTATCTGAGGGTCACGAACGTCAGCGATCAGAAGTTAGTGTTACAAGATGATACCCACATCGGTATGTGGCTCGAAGGAGGACGCGTACCTCGT
ATCCCTGGGTTCATATTGGTTGGATCGCGTCGGTATGCCGAGTGGCAGAATCTGGCGTTCCAGTCCACCACAGACCGTGCGGATGCGAAGGAACCTGAGT
TGGCGCCTATCGGACCCATGGTAGATCGACCCCGGTACGACAGTCCGACGGAAGTCTTGCGCCGCGATCATGGAGCCCCGAAGCCGGTCGTCGCACAACT
AGCCGCGGCCCAACCCGCTAAGATGAGATCAGAACCCGAAGGATCCCCGAGAAATCAGGAAGATTCTTCGCCCAGGTCCGAGACGCGACTACCCGACGAC
GAGGAAGTATGTTACCACGAAGGTGGCGATCTCTTCGCTGAAGATGTGGAGCGTCAGTTGGCAATTCTACCAGAAGTAGTGACTGCCACCGATGAGGTTA
CGATCGAAGATATCCAGATGGGCGATCCAGAGTCGAACACCCCGGAAGAAATCGATCGGCTGCGACAGATAATTTGGAGACGGAAACATCTTCTGATCGG
GAAAGGAAACGCGCTACCGCCGGCCGCCGTTGGCGCAGTCTGCGACATCGATGTGGGAGGAGCGGCTCCTGTTGCACAACGCGTCCGGAAGGTCGCTCCA
CAGTTCCGCGAGAAGCTGTCGGATCTGATCAAGAGCCTGTTATCGGCGAAGATGATCATGCCGTCGACTTCACCGTGGGCCTCTCCGATCGTAATCATCA
TCAAGAAGAACGGCGTTGACATCCGGCTCTGTATCGACTACAGGCTGGTGAACAGTTTGACGAGACTGATGGTGTACCCCATGCCGCTGATTAGCGATCT
CTTGGAAGACTTGGACAAAGTGCTCTGGTATTGCTCACTCGATATGGCAAGTGGCTTCTGGGTAGTCTCCATGACGGAGGGCGCACGGAAGATCTCCGCT
TTTATCACGCCATTCGGATTGTTCGAGTGGACGCGTATGCCTTTCGGGTTGAAGAATGCGCCACAGATCTACCATCGATTGATTGACAACGCGCTGTATG
GACACTTCCGAATCCGCGCCGGTCACGATCCGTCGAAGCCGATCGACGTGTTCGAGTCAGGCGAGCCGGAACCAGAGCCGAGACAGTCAGTGTTGGGAAG
ACGATCGTACATCGATGATATTCTGGTGACTGCAATCACTTGGGACATGCTGTGTGAGAAGGTAGAGGCATTGCTCGACACTTGCGAGCGATGGAATTTG
TCCATCAGCGTGGTCAAGAGTTTCTGGGGCCGACGAAAAGTGGACTACTTGGGACACCGAGTGTCCGCCGACGGTTTGGAAGCCCATCCGAAACACCTTG
AAGTGTTAGGCAACCTTCCTTTCCCGCAGACTCTGCGATCGATGCAGTCCTTCCTTGGAAGCTTGAACTACTACAGTCGCTTCATCGAAGACTTCGCGGT
CTATGCCGCTATCTTATACGAGCTGCGCGAAGCGGACTTCCACGAGATTGCCCGACAGGACAGATCCATTCCCAGCGAACAAGTAGCTGGGGGCGTTGTC
ACGCGAGCGGAAGATGCTGACCGCTGGGCCCGAGCGAAGATCGCATTCACGATGCTGAAGGCCAAGATCGTGTCCACTCCGGTATTGAAACATTTCGATC
CAGATCGCACCCCGGTAATCGTGGTCTACGCGAGCCAGTGGGCGATCTCCGCGGCACTCGTACAAGAGCATGATGGTGTGTATTGGCCAGTAACCTTCAC
CAGTCGTACTCGAAACTCCAACGAGACCAACTATGGGAACGTCGACAAAGAAGTCTTGGCACCCTTGCGGATGCTGGACGTGATCTACACCCTGTTGACG
ACGAGATCGATCTTGGTGCTGTCCAGGCATTCGACGCTGGCTTGGTTAGTCAATTCGGCCGGTCTCCAAGGGAGACTTGGCAACTGGGCAGCCTTGCTAT
CAGAATGGACACTGGAGATCAGGAAGTGCACGAAAGGGGAAGACGAAATCTTAGGCACGATGGCAGCAAGCATCACACCTCGAGCGGAAGTAGACGAGGC
GTTGATCGCGATCGCACCCGTGAAGCAGCCCCGACAGACGATTACCATGCCACCCCCCCTACGATCGGAGCGGACGAAACTTTGTTGGTCGCGAGCTTCG
ATGGATCGGCACGCGTCAAACGCAGTGGTGGAGCTTACAGTGCGATCATATGGAAGTTGCCAGAGTGGACGATCTCCACCGCCGCGTCGGAGTATATGCC
CGATCTGACGGTGAACGAGGCTGAATACCGCGGGTTGTTGTTATGCTTCGATCTGCTGTCCACGATGGACAGGGGGCGGATTGTGATCTGCGGCGACTCC
AATTTAGTTATCCGGCAAATGCGTGGTGAGATCGCATGCAAGGCCCCTGGCCTGTTGTTGTTGCGCGAGAAAGCGATGGATCGGCTCAGGTCGTGGCCAA
ACACGAGTTCCTACACATGAAACGAGATTGGAACCAGAGTGCAGACAAGTTAGCGAGTGAAGCTCTCCAACGGGGCGAAGGGATCGTAGTCACCTCAGAC
GAAGATCAACAAGACTTGATCACGCTCAACCGTTTGGACGAGCTCCTCAAGATGAGGGACGACGATGCCGTCGTCCGTGTGTCTGTTGTGACCAGATCGA
CGCGACGCAGACGACTGACTCCTGAAGTCCTGCAGGAAACGATTGTACAGCGCATGCGCGGTGAACGAATCATCCAAGCGCAGACTGAAGAGAAGTGGAT
CATCGATCTGAAAGCATACCTGAAAGGGAACGTCGAGGCTCTCACCGCGGCTGAAGCTAAATCGTGCGCCAAGGTCGCGAACGATTACGAGTTGGACGAA
AACGATCTGCTGTTCTATTGCCCGTCAGCCATGCAGGAGGAGGAGGACCGTGAAGAGATCGCGAAGCTGGTGGTGCCTGAGACCCTGCAACAAGATTTCC
TACATCATTACTACGCAAGTCTGGAAGGGGGACATCAAGGGATCGGAAGGACGTACCGACGAATCCGATCACACTTCCACTGGAGGGGCTTATACCGAAG
TGTTCAGCGCTATGTGGGAGAATGTACAGATTGTGAGACAGGGAAAGGCCGACCCTTCGTGAGAGGAGAATCCCCTGGGAACGTGCAAGCGACGTACCCG
TTTCAGATCATCGCTATGGATCACATTCCGTCGTTGCCCAAGTCCTTCAAAGGCAATACGGAGCTGTTGATCTGGGTAGACCTGTTCTCGGGTTATGTGA
TCGCTAAAGCGAGCGCGTCAAGAACAGCGCAGACGATTGCGGAGAACTACGAGGAATGCGTCTTCCGGCGTTTTGGAGCCAGTGAGGCTATCCGGCATGA
CAGGGAACCTGGGTTCGTATCTGATTTTTTCCGTGCTTTTAGCAGGATAGTGGGACAAAAACAGAGAGCCACGATGGCGTACCGACCCCAAGCAAACGGA
ACAGCCGAGCGTATGGTGCAGATGTTGACTCGAGCGTTGAAGATGTACGTCGCAGATGTTAACCAACAGGACTGGGACGAGTACGCAGAACGCCTCACAT
TCGCAATCAACACGGCCCACGATCGTGTGCGTGGAGACACACCGTTCTATCTGATCCACGGATGGGACCGACGATCCACGTTGGAGGCGGCGCTACCCGT
CGGGAGCACGCGCCGACGTGATCGCGAGCCAAAACGATGGCGATTCCACATGCAAAGTCAATATCGACGCGCAACGGAGCAGGTAAATGAGCGGCTCCGG
GAAGCGATCCAGTAGCGAGACGACGAACACAACCAGAACGTCCGATCCCAGGAGATTGAGGCTGGTGCACAAGTCTGGCTGTATCTGGACCGGGTGAAGG
AAGGCTACGCGAGAAAACTGGCGCATATGTGGCACGGCCTGTTCCGGGTAGTCGAGATGGTAGGTAATCACGCAGCGAGACTGGAGACTGCCGGCACGGA
GTACCGCTTATTTCCGATCGTCCACGTGTCTAAGCTCAAGCTGGTGCGAAGTTTTCCCGATCGCCCTACGTTGGCGCTTACCGTGGTTGAAGGCGATCGT
CTCGATTTTGACGAAGCAATCCTGCCAGAAGATAGTTGGGAACGCAGCCTTGGCGAAGACGAATACGAGGTTGACAGGATTGTGGATGTGCGATAAGGGC
GGCGTACGCGCTATGGGCGAGTTCATCGAGAGTTCCAAGTGTACTGGAAGGGCTACGAAGATCCATCATGGGTCGACGAGGCCGACCTCAACTGCGGAGC
ATTATTGCTTGAGTATGAACGTGAGGTAACTAACCGCAACCGATTCAGCGTCATGCAGTCGCATGAGGCGGAGGAGGAGGGCTCGTAGCAGGTTGGCTGT
TGCGGGCGGAAGATGTGTAGAAAGATGTGCGGGGAGGCCGCACATCGAGAAGGAAGGGTTTTATGTGATATTGTTGTGTAGATCGAGGACGACTGTTCTC
GATCAGAGTGGGATGCTCGATAAAGCAAGAAAATGATGAAGAAAAACAACGAAGGGAGAAGCCGTGGGGATCATATTGAGAAGATATACGATCCACTAAC
CACTTCATCTTAGTCGGCGACAGGAGAGAATTTGCCGGTGAGGCGGGGCAGTTAGGAGCTCGGATGATCTTGAAGGTGGCCGCGATACTGATTGCGCCAC
GGGTCAACCAGATCGACGGCACGTAGGGCGTCCACCAGGTTGGACGGCGGAGAGCTGCTACCAAGCCCAGGGTACCAAACTCGTTGTTCGTGCGCCCGGG
GATAATGCAGAAAGAAGGGTCCAGCAGAATATCCAAGTCGCAGTGCCCTGCAATCATCCCTTGCAAAATCAACTTGAGGAAGCGTTTCCAGACGGCACCG
AAACGTGATCGTCTATGCTTGCGATCTTCCCAAAGACGTGCCAGATATGTGTTCGATTTACGAAGCGCGGAGCTGATCATGAACGCGTGCGTAGCCTCCC
ATAGAGCCTGCCGGTGATCATCTTCAATTTCCAGATACTTCCGAGACATCGCCTCGAACCAACCAGTCACCTCAAAAGATAAAGGTGTCACCAAGACGTT
GAGAGAATTCCACGGCGTCGTCGCGTAAAGTGCCGCAATGTTGCTTTCGGTGATCAGACCGGGTGACCAAGCGCCGCGACGAGGCGATCGACTCTGCGGC
GGAAAAAGCCAGTTTTTAGGCTTTGCCAGGTGATGAAAGAGCAACTCGATGTCCATCTCCAAGACACTGACCCGGCTCAAAGTGCTCGCCGACCACGGGC
GAACGTCCGCGGCCGCCCTACGAGAACGAGCGCAATATCCAGGGATCCAGATAGCACGGGGGACGGTGGGACGATCAAGCTGATCCAGGGCAACCTGCGT
GAGTAGGTGATTGCGGTGCGCCCTCGGTTCATCAGCTACGCTTCCGTCACTGTCACCGTCATTCTCGTTGCCACGATCGGAATCACGTGGCGCAGTCGAA
TGACTGTCCGCACCACCATCACTCTCGTCACCAGAAGAGGCACTGCCAGGGTCGTCCTCCAACTCTTCGAGTTGATCACGATCTTGGTACGAAGCCTCCG
ACGAACTGGATGACTCGATGCCAATGGGGCGGCTGGATGGTCGACCGCTAAGGCTGCCGGTGGAAGACGAACGGCGACGACCGGACGATCGCGAACTCGC
GAGAGCCGCCAACAGAGAGTCGTCGTCACTACTGGTCGGAGAGGCATTAACCGATGGTGACCGCTGAGATGGAGAGCGATCGCCACCAGAGAGCCTGCCG
GAGTTAGGAGTTGACGGTCCTGAAAGAAAAAGAGATCGCGAAGCAGATCCACCGTGAGAAGGCGGAACAGTACTTGATTCCGACACTGGTTTAGGAGATC
GCTGTCGCGGACGACTACGGGGCGGACTCGAGCTGCCAGCCGAAGAACTACCGCGCGGTCGCTTGTCCGTTTTCTTGGATGCGGCAGGCGTCGACTTGGA
AGAGGGAGAAAGTGGCGTTTCGTCTTGCGCGGGTTGGATGAATGAGATCAACCCCGCCACCCTATGACGGAGCTGATCGCGGTCCCTGTACAGCACGGTC
ACAAGCCTTCTTGAGAGCAGAAGACGCAGACTGCGCGTTGGCCAAGTCAGCAAGGAGCAACTCATTCTCGTGATTGAGCGCCTTGATGCGGCTGCGATCT
GCCTGCGAAGCCTTCAGGCCATGTTCCAATCGCGCGATTGAAGCCCGCGCGTTATCAACTTGGATCTCTGGTACAACAAATAGAGGAACAATGTTAGTGT
CACGCACGAAAGATTTATCGGATGCGAGGTGGACTTACGAGTGGAACGACGGTCGGCTAACGCTCGATCGCGATCAGCCATGATCCGCTGCAGATTCTTG
GACGTGGTCTGGAGAGTGGCCTCAGCGGCCACTGCACGAGAACGAAACTGTACCCTCTCTGCGTCAACACGATCGAAGTCCCGCTTGGCCCGAGTTGTTT
GCTGAGCCAGCTGCGCTTGAAGATTAGATACGCGTTGCTCGAGATGCTCGTTCTGACCGCGCAGTCGAGATGTCGCGTCCTCCAATGCACGCTGCGACGA
CTCGAGCGCACCGAGGTTCTTGTTGGCTTCGGCCAAATCCAAAGCGACGCGATCGCGATCTGCGATCGCCTGGTCTAACCCTTCCTGTAATGTGGCGAGA
CGACGTGCTGACCCCTGCGGCTGCCTTTTAGCCGCCGGAGACTCTGCATCTGCCAGACGACGAGTTAGATCGGCAATCTCCGCTTGTAATCGCGTGGTTT
CCTCCGCGAGGACCTCCTCTGCGACGCGCAAACGATCCCGCATGGCTGCGATCTCGTGCGAATTGTCGAGACGCTCGCGCACTGCCGTCTCGAAGTCGGC
CGCCATCTGCCGGGTTTCTTGATAACGCCGGAATAGGAAATCATATTGGTGCTGGCAATGCAACACATAGGGAGAAGCAGCCGCGTACGCGGCGTTTAGA
TCGGCCTCAAACCGATCAGCACGCGCCACCTGGTATCGGTATGCCTGCTGCAATATCGCGTGATCGTCGCTGAGATCCGCCTGGGCCTCAACACGCTCCA
TCAGGGACGAGAATACTGCCAGAGACTCTCGGGTGGCGCTAAGGTCGACGCTAGGGAGCGCTACACGAGCAGTGGGGACGACTGGAGCTTCAGAGGTACG
GCCGGCCGGACGTACCAGACGCGACAGCGGGATGGTCTTCGGGTGGAGTATCATTCGCGCCAGCCATGATTGGATCTAGCACGGAGAATGGTGGTGGCTC
AGAGAAAGAAGCAGAATTGCGACGGAATGCGCTGAGACCAACCGCCGTACGGCTGGTCGCAGAGCAGGGGGCGATTGAGGTGAAGCGACCTGGGTCAAAT
TGCCGATGATGGGAAGAGATCGCGTCTGGACTGATTGGACCAGAAGGGTTGGGGTTGGTGCCGGATATGTCCGGATAGCCCAGCACCTGACTTGGTACCA
CAATGATGGTACAGGTAATTTTATCTGCCTGGTACCACCCTTTCGGTACAGTCGATCATCCGGACACTTGCGATCAACCAGACATCTGCGATCATCTGGG
CACACGCGATCATCTGGACTCACCTGATCAGATCGACATGGTACCGCCACAGTGGTACAGTGATGGATGCTAGGTACAATGTTACTGTCATTCCGATACG
AGGTCAAGATATACAGATGGAAGTTCAAGTGTGATGTGCAGTCGGTGGGCACGCAAGCGGGATGGGGATAGGGAGAGAGATCTTTAGGACTTTTACCTTT
GCTTAAATAGATTCTGATTTGCCTTGCAAGACACAAGTGGCGTCCACACATCCCGGGGAAGGAACTACATTGGCCTACCCGAAGAAGGGCTCACCTAGTC
AACCAAGGACACGTCGCACACCTGGATAGCTTGGCCAGGGGGCGATCGTACAATCTCATCTCAACTCAAGACCCCGCCAGAGGAGGCGGCAAGCAACGGA
AAGGGCTATAACAGCACACCCAAAGGACACCCCCCACGTGATCGACTTACCCCAAGACCCGATCACCAACAACCGACGACCGCGTGAAGGATACCCGCGT
GGCTGTCATCCCCCATTCCCCGGAAGGAGCAGTTCAGCTCCAACAAGTTCCGCCTTGGTCACACCCTTGACGTCCTTCAAGAGAACACCGGAAGAGCGTA
ACCCGCCCCGCCGTCGGGTACACAAGGTGACTACAAGGTTTTCTGATCACGCCTGATCAACGGAGTACCCCCTCCGAAAGTCGGCAGTCCGGGCGTACCG
CTGGTGAGTTTGGATCGCATCATCCATTTTTGCGATCCCACTCCGCCACAGAAGTGTTAGGAGTATACAAACTCCAAGTGAACGGCGGTTCACTAGTTCC
CGGTCTTGGGGAACGGTTGACTTAGACAACGTAGTTTATAGACTGATATGTTTATAATTAGTTACCTAGAGATCGTCTTGCAATACAATTCCTAAGTCAA
CTATAGTTTATCCTATATGTTTTATGTATGGGTGGCTGTGAGCCACCACCACGTGTCAGTGATGTTGGGTACACCATGTACCCAACTCGGAAGAGTGACG
GGCACTCTTCAGGTAACCCCGTTACATTATATCCGAGATTTTTTTTTAACCCTTTCGCGAGGAGCTGCTATAGACACAACGAACTATACTATACAACGTC
AAGTCAATTAAACTCAAAGGGCGCAAAATTCGCCCTTTTAGTTGTCGATAGAGACGGGGCGTGTGTGCAAATCAAACACGATGCAGTCGGCACTGATGAT
GTCCAACCTAAAAGGGCGCAAAATGCGCCCTTTTAGATTGCATTTTGATTGGCTAATAAGTGAATTATTTGGTGTGATCCAGCTGAAACAGCCCTCTACT
ACTGGAATTGGTCAAAATGGAATGGTACAGCGTTCCACCACGGAAAGATAACAACGAAACTTACGAAGATATTCGCCTCGTCGACCGTTTTCTGGGTGAT
GACGCGCCAACGTTGGCCGGAGGATGATGCTCGGCTTCGGCTTTCGCGTGCGCTATATATCGCACCACTCTCTACCGGACGTGACTAGTTGGCTATAGCT
CTGTATCTGGCTCGTTTTGTCGCCAGCATTCTCACAGCTAATCGCTTCAGGTACAGCTACACAGCCAGTATGTTTGTATTCCCGGCAATGTAGAGCAATG
AATATGCGGGTCACTCAATGGGTGCATATATCTTCGTGTTCGTATGACTCCGTTAAGGTATACTACGTAGTATCTTCGACGCAATGCTCTGGTGCATATA
TCTTGCACACTGTATTCCAAAAGGGGGATTGCGTACGAAACGCTTTTCGCGCCAAATCATGGCGCCCAAAGCTTGGTCCCTACTGTCAGACTTCATAGCT
TGTACGTTTGTATGTGTATAAAGAATAAAGACTCATCCAATATCTGTATTTAGAAACCTTTATATTGACCACAAACACACGACACGTATCAACCTTCCAG
CTGATTCCTTCTCTCATTTCTAAAAGGAGCCGTATATGGCGGAAGCGCTGCCCGGGCAGAAGCGCAAGTGTACCGGTCCTGTAGGCGCCAGCAAGCGCCG
CCGCGCGGGATCTGGTGTCGATACAGCACCGGCGGAGTCCGCCAGCAGTCTCGGAGGTGTTGCAGTGTTCAAGGGCGCGTGGGCCGCGCTGAAGAAAGCA
GGATGGACGTCCAAGAAACCGTCCAGCAAGGGTCTTGACTCGCGTTACAAGTACATTCGGCCTGGGGGGTGTAGAGGGTGCTGATTTCCTTCTCGGCGAG
CTGGCCGTGCTGAGGTATGTCGAGGAGGTGCGCAACCGTGACGCCGCAGCAACTGCAGCTAGGCAAGACGTTATGTCTGTGCATGCAGCGGTATGACAAG
TGGCTAGGTAGCTGTATGGCTAACGTTGCACTTGTTTGTGGTGTAGGCGTTGGAGCTCAACGTGGAGAAGACAGTGGCGACGTCGCTGGCAGAGCTGCTG
GACAGGCAGTCACTGCCGAACGTCGCCGGCAAGGATCTAGGCATGGCGACGCCGATCAGGAAGCCTCAAGCGCTGCAGGTGCGGTTGCGTCTTGGGAAGT
TGGGCTACAACAACGAGTGGCGCGACTAACGTTGTGTTTGTTGGTGGTTTGACTAACGGTGGGCGCATTGGTAACGCAGAGAATTATGTCAGCGATGAAG
TCATGGAAAGCGTCAGTACAGCGGCGGTGGTCGCTCACGACCAAGCAGTAGTGACCGTGCCTCTAGTGCACGTAGGTAGACGACGAGAAGGTACGGTTCG
TCCGGCTGCAAGCGTCGCCAGCCCAGTAGGTGCGACTTGTAACAAAAGGCAGCGTGAGGAATGAGCGCGTGCCGTGACTAACTATCGGTTTGGTGTTGAT
GCAGGAGTTGACGGCAGCATCGTTGACATGACCGACGACGTCATGGTGGACGCTGAAGGTGCTGCCGACCAGGCAGGTGTCGCTGTGCCTATTGAGAACG
AGCGTGGTGGACGTGGTGAGCGTGGTGGACGTGGTGCGCGTAGTGCGCGTGGTGAACGTGGTGCGCGTGGAGGACGTGGCGCACGTGGTGGAAGCGGCGC
GCGTGGTGAACGTGGTGCGCGTGGGGGACGCGGTGAACGGGCTGCTCAGCGTGCAGCTCGAGCCACAGGTACTAGAAATGGGGTGCTGGATCTCAGAGTG
CAAGCAGAAATAGATAAGCTAATGGTGTGTTGCTGGTTTTGCAGGAGCTGGTGCGCGTGGCGGTGATAATGGTGACACGGCTGGAGCAGTCGTTGTGA