Transcript Name :
Phyra_g12104
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_351929
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.2290.239110
InsideOutsideTMhelix
1-25
26-48
49-84
85-104
105-495
NN-scoreoddsWeighted Score
0.8252.4160.005
PositionContextScore
54VRHRRRR|RT0.57
57RRRRRTR|QL0.504
TypeScore
endoplasmic reticulum44.4
GO
*** None ***
*** None ***
*** None ***
Sequence
        1986 bases(100 bases per row)
TGGCATTGCGAACGTCGCTCGGCAGCAATGCGCACACGCTCGGGGACTCATGCATCGACCTGTACGCCGAGAAGGTCATGATCCCTCGGATCTCGCTCTT
GTCGCTACTCGCGGGGCTCTCGGTGCTCACGACGCTGCTAGTTCGTCACCGTCGACGCCGACGCACTCGCCAATTGGCAAAGCTGCTGCCCGGCAAAGTC
GTCGTTGAGACGTCGACAGCTCCCGAGGACGAGCTTACCACCCGCAAGCGCTGGTTCGCGTGCTTCTTGGCCACGACCGTGGCGTGGATCACCATTTTTC
TATGGAGTTTCCACGCGTCCACGGCGATGACGACCACATCCGCAAGTGGGGCGCAGGGACGACCCCGCATTGTATTCAGCTTTACGACAACTCCGCGAGG
AATCGACGAGATGAAGCCGACGCTGGACGCTCTAGTGCAACAGGAGGGGGACGGATTCGACGCGGTTTACGTGATCGTCCCGAGGACGTATCGAGACAAG
GAGGTGGCCATCCCGACGTGGCTGGTGGACGATGCGTCCACATTGAACCGCACCGAGTTCCGCGGCATCGCGTTTGCTACCGGGGCGAGTCCGTACCACG
ACAAGTTGAGGCTCATTGTGCTGGACACGGACTTTGGTCCAGCCAGCAAAGTGCTGGGAACCCTTTTGGTGGAGCAGGACCCGGAGACCATTATCGTGTA
TGGTGACGACGACCGCGTCTACCCAGCGCAGCTGTGCGAACGTGCACTGCACTACACGCACAAGTTCCCGAGCGACGCAATCGCGGTTCTCGGTGGGTGG
ATTTCGGCGGAGGACGGACTGTACTGCGGGCGTAGTCTGGCAGTAGGAGTCAACAGTGTTTCGTTTGTGGGGGGAGCTGGGGGAGTTGCCGTCAAGAGGA
AGTTTTTCGGGCTTGGAGAAGAGATCATGCCGGCATTTGAGGTCACCAACATGTCCAAGGCGTGTTTCCTGGGTGACGACTATTATCTGTCCCATTTGCT
GAGCAGGAACGGCGTCCGTCGACGGATCGTGTCCGATAGCTGCTGGAACATCGAGGCGCTGACGGAATCGTTCTCTCATGGTGGACTATCGTACGCACCG
TCGGAGCACCCGGGAGGAGCGAACGTCGAGCACTATCAGCAGTGCATTCGCGAACTGGGCAAGGAGCACGACCTGTCTCATGACGGCGAGTTCGGGTCGA
CTTATATGTTCCTCTTCTCTCGTACTTGGGGGGTGCTTCGAGGTCTACGGAATTTTTACTTCAGAGGTGAATTCGTGTCATGCTGATGGAGGTCACACCT
GTACAATAGACTTTCAAAAAGAATATATGAGCCGGCGTGACAATAGCTGATGGTGCTAATCTACAATACCTGGCATCATCCGATAGCGTTGGCCAACCAG
AAGAATGTGATCTCGAACTCGTGGAGGGAAACTCCACGTACTGTGATCTCGCAAGTTTCCCGGCCAAGAGTTCAAGCGTCTGTGTTCGTGAACAACTCAT
GACCACTTGCCACTCTCCAAATTGCAGTAACAAGATCACCTCAGCGCTCTACAGATGAGTCCTCGCCTGGCTGTATTCGCGTTCTTCTCTATGGTTGTCA
TGATCGCTTGCAGCGTACAGTATGCAGTCGCGATGGAAGGCGAGCTCCGGCTCTACAAGGAGCCAGAATTCAGACGACTACGACGTCTCATGCGTGTTTC
GACTAGCAACCTCTGCTACGACATGCCGTGCGCGTATCTCAACACGATCATTTCGTCTGCAAGATGGTCGGGACTACCGACGACTGGAGCAACGTTCGCG
GATGGGCAGATCAAAATCGCCTTCTACGCGGGCAGCAACTGCACGGGTAAAGTCGTCGCCGTGAACACGAACGTCGGACAAGTCGACAATTTTGCAAAGT
TCGGGATGGACAACGCTACCGCGTCATTCGCGGTGCTGGAGACGTCAACGACGATGCAGCACGAGTCGAGCAACATTTGCGAGTGA