Transcript Name :
Phyra_g12100
Orientation:
(-)
Number of Exons:
1
Description :
small nuclear ribonucleoprotein Sm D3
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Ribonucleoprotein LSM domain, eukaryotic/archaea-type1.1e-16SM00651
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ribonucleoprotein LSM domain, eukaryotic/archaea-typeIPR006649
Y-scoreD-scoreY-pos
0.1040.08418
InsideOutsideTMhelix
1-116
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        350 bases(100 bases per row)
TGTCCAAGACCGTGGGGGTGCCCATCTCGCTGCTGCACGAGGGCGAGGGCCGCACCGTGACCGTGGAGCTCAAAAATGGCGAGGTGTACCGCGGCCACCT
GGCGGAGAGCGAGGACAGCATGAACTGCCAGCTCAGCGATGTGGTGCTCACGCAGCGCGACGGCCAGAAAGCCAAGCTCGAGCTCGTGTACGTGCGTGGG
TCGCAGATCAAGCTCGTGATCCTCCCGGACATCCTCAAGAACTCGCCACTGCTGGGCAAAGTGCAGGCGCTGAGCAAGAAGAGCGAGGACCAGAAGAAGA
AGAAGAGCAGCAAGGCCAAGGGCGGTCGACGCCCCGGCCCCCGCAAGTAG