Transcript Name :
Phyra_g12094
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_339856
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0270.02830
InsideOutsideTMhelix
1-512
*** None ***
PositionContextScore
57DRHRKKK|LI0.662
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        6424 bases(100 bases per row)
TGACCGCAGCAAACGGCAAGAAGAAAGACCACGAAGACGTGCTTGCGCGACTGGTGCGTGACCTAGAGTCGAAGAAGACTCTGTGCCGTGTCAAGGACTA
CGCTGGTGTGTCCCTCGAGCAGTTAAACCAGCACGTGAAGAAGTTCGGTCCGTTGGTCCATCCAATACTTGGCGAGCAGCCTGGTTTCTTCGTCGACGAA
GGCCGATTTATTCCATTTCGGATGGTGGTGTTTGGGCGCAGCGTAATCGGACCATACCTCTGCAAGGCGCTGCTGAATTGGGCTGCGTGGAGTGGCCATG
GTGGAAGAGTGACAAATGCGCTAGATGAATACGTGCTGGATGGCACAACGCTTCGGGTCCCCGATGTGGCGTATGTGCCTCGAGATGATGCAAGGCAGCT
GACCGAAGCTCAACGATGGACTCGTGGTGGAGAACCTTTTGCTCCGACGTTCGTGGTGGAAATCGACACTCTCACTGGTTCACATTCCAAGCTTGGTGCT
CTCGATCACAAGATGCGGCACGAGTACTTTCCTCACGGTGTGCAATTGGGATGGCTCATTGATCCAAAGAACAAAATCATGTGCGAATACAAGCGATGCG
CCCGAGGAAATTGTCTTGTTCGACGCGTTGGCAATAGCGCGTGGAGAGATCTTGATGGTGGTACCATTCTTCCTGGCTTCACTGTTAATTGTGAAGATTT
GGACGCTGTGTTGGACCAGGAATCCGGATCGTCATCGGAAGAAGAAGTTGATCTCGTGTGTTGTGTTCCAGCTTGTGGTGTACGATTGCGAACGTATGGT
GAACATGCTGCTCATGCCGAATGGCACCGTGCTGAAAGAGCTAGAGCTCGACGTAGAGCAAACCGTGCGAACCAATAATTCAAGTGAAGTTTTTCACGTT
AGTAGACGCAACGCTTTTTGATACCTTGGATGTCATAAGAATAAAAAAAAATACTTGAAGTAGAACATTATGCCGATAGTTTTACATTTATTATTTTTTT
CTCAAAAAAATTAAAGGGGTATGTATATAGATACCACTAACAGACCATGTCGTTCGAACTTACTTTTGGAAAATACAAGAACAAGCCTATTGAGGAAGTA
TATATATATGAACGATGGACCCAACACAACCATTCTAAATAGCGATTTGATATCAAGCGCAGGGATATCACCCATGGATGCTGATTTGAACTTTTTCGGG
GAGTGAAGCTCCGAAATCTGGAATCGTACTCATGATTGAAAATAGCTTTATCTATATAGCTTGAGACAAAACAAACATACACGGATTTTTAGCTATCCCC
CACCGATCTAAACCCCTGCATTCTATCTCACGCTGGATGCAAGCGGTTTCCTCACCTACGATTACGCACAAACTCTATATCTCGATAAAAACGATTATCG
ACTCACATACATCACTGGAATTATCCAAGGGGCAGCGACACCTGGTGTTGCCCTTATTCCAGGAGCTGCCGGTGATATTAGTGGCATTGGTGCGTTGAGC
TGACTGTGAATGGATCATCCGTATCGGCCTCACCATCGTATGTCCTAAGCATTACGCCAGGCACCGCTGCTCCCTCTAAAGCTCTAGTGCTTGATAGCTC
GAGCAATATCTCTGGTATCGGCTCTCTGTCAGCAACCAGCCTTACAGGTACTCTACAGACAGCAGCTCAGCCGAATATAACAAGCATAGGTACTCTTCAA
TCGCTGAATATCTCTAATTCCGGAACCGCTTCCGTCAATCTCCTCAATGTAGTCCAGCCAAACTTGGCATCGAATGGTAATATCGTTATTAGAATCGGTC
GATCTGCATCTATTCATGATGGATCATATATCGCGTATAACAATAGCGCCACGCCGTCTAGCCAGTATCTCTGCATTGCCACAAATTTGAATGATTATCA
GCTAGTCATTTGCAATAATAGCAATATTGGGATCGGCACTAACGCCCCGGAGACAAAATTAGATGTAAATGGCGGAGGCCGGTTCGCTGGCTCACTGTCA
TTGAGCGGTGCATCATCAGTATTGAGCATCACGGGTGCCTCTGCATATGTCGATGCTACCCAATACCGCCAATCAGGAACCACGTACGATATCAGTCTAG
TTCAGTCTCTCTCAGGGATTGCAGCAGGCATAGCAGCCGCCTCTAAAGCTCTAGTGCTTGATAGGTTATCCAATCTCAGTGGTATTAATATTCTATCTAT
GACGTCATTAAATGTTTCAGCTAGTGGAGCCAATGGACGGATAGCACTCCTCGCAATGCCTTCACTATCAACTGGCAGCATATGTCATTTGCTGCTTGGG
CGTTCAACTGCAACTAATGGCCGCATCAACTATATGTGGGATTCATCTAACTCTAATAATAGCTATCTATCACTTGGCACGAACGGCTTGAATCGGCTTG
TAGTCGGCGGTAATGGCTTCGTTGGTGTGAAAACAACCACACCAGCGAGTGAATTGGATGTAAGTGGTAGTGTAAATATCTCCGGTACTCTCTCCATTTT
GGGTACAGCTGCATCAACTAGTTCAAGTACTGGGGCGATTCAATGTTTGGGAGGCGCTTACTTTGGAGCTTCATCTAAGATTAATTCAAATCTAGTCGCT
AATGGGCTCACGATGGGACTTGGCTCGTCAGGAAGTCAGTCATCAACGAGCAGCAACGTCCAGTGGTGGGGATCGACCCTGAACACGCAGTAGTCAATTT
ATACAGAGCCTCAGATAGTCAGATAGTGCTGGTTTAGTATTAGCAAGTACTTGCAGTACAATCAGTTCCAATATCTGTTATCCATTGCTCAGTCTCGTAT
ATTCGGAAAATGCCCAGAGCATTTCTCTAAATAGTGCATCGTCATTATCACAAGCTCTCTTTCAAATCGATTGGAAACAATCCTCGGTATCAGTGTGGAA
CTCGCAAACTGTTAAACATATGCTCGATTTCAGCAATACTCGTCCATATAAAACTGGATATCCAATGACCTTAACAATAGCTACATCGACATTACTTTCA
AGTTCGTATCCGAGAGCAATATTTACCTTGAACGAACTCACTTGAGTAGAAAGAACGTTCTCTAGCTTGCCATAGAAAACAGATGGCCCAACTCCCTCAT
ATAGGTGAGATTCCATATGATTACCATTGTAAAAACGGTACTTGGGTCAGCCTTCAAAAGGGTTTTTAGGCTGATGCTTTCCTCCTTGTGCACGGCACGT
ATTGAAGGCATGCATTGCAGGCATGAGCTTTGAATGAATCACTTTGAGTTTTACTCTCTTGCAAGCAAGTGCCTCGTCTTCGGTTGTCCTCCTACTTCGC
AAATGTAGTCTGGCGACATATACTTCTTAAGAGTATCAATGGAGACATTGTACTCCTTCGCAACCAGTCTTTGATTGATTGGGCGTGACATATTACTAAC
ATATAACCATCTTACCATCACTTTGACGCGGTAGCTGCTACCCCACTTGGTAGCTTGAATATTCAATCTCTTTAATCTTTCTGGTACGTACGCTAATATA
TTGCCTATATATAAACTCGAGGTTATATTATTTTCGTGAAATCGACTTTATAATTTCGGATCTTGTATCAGGACCGAGTTGTTCTATATTGGGGTTGTCT
TTATATGTGACGGGAGTCACACAGCACCTTGCGCTTGAGGAAGTGTTAGGAGTATACAAACTCCAAGTGAACGGCGGTTCACTAGTTCCCGGTCTTGGGG
AACGGTTGACTTAGACAACGTAGTTTATAGACTGATATATTTATAGTTAGTTACCTAGAGATCGTCTTGCAATACAATTCCTAAGTCAACTATAGTTTAT
CCTATATGTTTTATGTATGGGTGGCTGTGAGCCACCACCACGTGTCAGTGATGTTGGGTACACCATGTACCCAACTCGGAAGAGTGACGGACACTCTTCA
GGTAACCCCGTAACATCCTCCCCCACTTAGACTCGAACTTATCGACCAATCGGGGCGAGCGGGAAGTTTCTCTTACTTCCTCGCTCGGTCGATAACCATC
GACAAGAGGCCGAGCGTTTCCGCTCGCGCTCTCCGCTCTCCCGGAGCACTGGGGCATTCCCAAACGTGCTCCCTGGCCTCCACGTCGGCCTGGCAAGATG
CCTCAGAGGAAGACACCTCGCGACGCGAAAGCGTCCAAGACTAAGCCCTCGAGGGCGAAGTCAAAATCGGCCAAGCCTCGCGGCAAGGCCTCCGCGTTGG
GGGAAGCCGTTGATGCGGCTTCCCAGGCGATTTATTCGCCTGGCGACGCGTCCGTATCCGCGTCTGCGAGCACGCGCTCGCGACGCCGTGGTTCGCCCGA
TGTACCACCGGACGACCGTCCAAACCCTCGGTTTGTACATCGGGACCGCAGTCCCGGGTCGCCGAGCGACCTTGAGCACTGCTCCTCTCCTGGAGCAGTC
TCACACGACGAAGGTGACGCGCCAAGTCACAAAGGCGCGTCTGAGGACGTGTCCTCGGTCCATGGGGACCTGAGTGGAGATGGGGACAACGTGCCAAAGT
CTCCTGCGGACACTGGGTCCACGAATGCCAGCGCCGCGGGTGGCCAGATGGACGGCGACGCTAAGGCAGCGTCGCCAGCCAAGCGCTTGACGCTCGGCGA
GGGTCTCCAGCGAGCCCGTGACGCCAAGGCCAAAGAGGCCGCGTCGAAGAAGCGAATCGCTTCTCGGTCCCCTCCCAAGGGCCGGACTAGGGGGCTTGAT
GTCATCAAGTCCCTGTTTGACTCCTCGGAGTCAAACTCGGAGGATGAAGAGGGACAGGTACATGTCCCGGAGGAGGTCGCTAATGCGCTCGACGAGCAGC
AAGAACGCCTCCAGGAGGCCCGGATGCGCCAGCGCCTCTCGCCTCCGGCGCCGCAACCAACTCCTGGCGGGGGTGCTTCGGGAGAGAGGGAGTCCAAGCA
CCCCAGGGGCTACTTCCCGCCCGATGAGAACACGGGTTCTCCGTTGTTCCTTGAGAGGCTCGGCGCCCCTCGTGGCCTCATTGGAGGCCCCACCTCCCGA
GGCGCGTATGAGCGCGACTTGATCCAAAAGGTGGACTTGTTCACCGAGGATATTGAGGCGGCTCGGTGCGTCCTCCTGGCTCCGCATCGGATGCCGCTCA
AGGAGTTCACCACCCTTCGCAAGAAGGGTGAGAACAGGGGTGGTCTCCACCCGGTGTGGGGTTACCCTTGGGTCCAACCCGAGAACACTTACACCGTGGC
CCAAGCTGAGGACCTGTTCTGGCGGTGGGTTGGCCTGCGTGGGTATTCCGCCCAGGAGCTCGATGAGCTCAAGGAGGATCGCCTGCTGCATCGAATCCTC
GATCAGCGCGACCTCCGGATTCGGTTTGCCCACCTCGTGAGTAAGCGGAAGCTGTACTCCGAGATGGAAGGACTGAAGCGTAGAGCTCAGTCCAGCGCTC
GAAATGAGCGCGGGTACGGTGTTCATGCGTCTGCCACCGTACCCCGTCCGTCGGCTAAGAAGCCGCGGACTACTTACGAAGCTGTCGCCGCTTCTGTTCC
CAGATCGCGACAGCCTTCGGGCAGTCAGCCTGGAGCCGCTCGATCGGCTCCCATGAGTTCTGTGACGAGGGATACCCTCGCCACTTCACCAAGAGCTGGC
GCCTCCTTTGGCGGCGCCGCTCACGGAGCACACGCTCCACGTGGTAGTGGGTTTCCCCATTACGGTCGAGGAGGGCCGGCGGAGGCCTTGCTCGACTATG
CGTACGATGCTCCGCCACAGCGTGAGGCTCCGAGATCGTCGGCGCGATCTCCCGATCAGTCCGTGCTGCTTCAGCAGCAGGAGATCCACGATCTCCGTGA
TCGAGTGTACACTCTGGAGATCGCATTGGGTCTCGGCCCTGGTGGGCAGGCTGCCGCTCAGTCGGGAAAGCCGGGGTCTCTTCCCCTCCTTCGTGGGGAT
GTGGACCGACTGAGCCAGGAGTGTGGGGATCTCCACTCCCGGGTCGATCGTCGTGTCGTCGTACGACGTCGACTGTCTTCGCGACGAGGTGGCTCACCTC
CGTTCTGAGATCCAGAACCGGCCGAGCTATCCGGGCTATCGGGAGCCGCAGTCCTATGCGTACTCCCAGCCGTACTACGGCTCCTACCCGTACGGCGGGG
CGTCTTCGAGGCCGCAGGCTTACGCCTACGACCAGTCCCCTGTGCCGGCTTCCGCGTGGCGGTCGCCACAGCGGGAGGCGAGCGCTCGGTTCGAGGTGGT
GATCTCGCCACCTCATAATCCCCTTTCGCTTCCTGCGGGGGATCAGAAGCCTGAGTGTCGTGGTAGCGCTTCAGACGACCCACATAAAACGTCGGGTGGG
TTGTCATCGACTTAGGCAAGTCGATCGTGTAGGCGGAGCCATGCCTGCTCAGGACCTCAAAGGGTCCGATAAACCTGTGCTTCAGCTTATTGCTGAGCAC
GGAACTGACCGAGTTTAGTGGTAG