Transcript Name :
Phyra_g12088
Orientation:
(+)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_432418
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ubiquitin0.0000093PR00348
Ubiquitin0.0000093PR00348
Profile scan predictionP-Valprediction_id
Ubiquitin domain12.64PS50053
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
UbiquitinIPR019956
Y-scoreD-scoreY-pos
0.0440.07914
InsideOutsideTMhelix
1-325
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        6964 bases(100 bases per row)
ATGGCCACTCCACGCAGCCCAATTCAGCAGCGCCTTGCAGAGGTATGGTCCGATTACGCTGCGCCCAAACACCACCATCCGAAATGGAATAAATCGGCCT
TCGTCGACGAAGAAACCAGGCTGCTCGCCAAGTATTGGATGGACCAACGGACCGAACTTCTTCACGTGCTGGTTTAGCTGCTCGAGGGACACACCAGCGT
AGTCCTTGACACGGCACAGAGTCTTCTTCGACTCTAGGTCACGCACCAGTCGCGCAAGCACGTCTTCGTGGTCTTTCTTCTTGCCGTTTGCTGCGGTCAT
GGTTGCCGATGCTGTTCTTTCTCGCACTGGCAGAAGCAAACAAGAAAGACCTTGCCCAGTGTGGTCCACGCTACGAATGAATTGACTTCAAATTGAATTG
GTACTTCCACTAAAAAAATGATCAATTCAAATTTGATTCATCAGTGACGGTTCCGAGAACTAGTTCCATACCCAGGAACCGATAGGTAACCGCGGCATAA
TCCGACGCATAATCATGTCGGCAGACCTCCGATCCTCCACGTTGCTGTTTAAATGGCCCGGAAAGTCGGAAAGTGGGCAATTCGCGCTCCACTGGAGGCC
AAGTTGCCCGACATTTGACTTTCCGAGCCAAACAAACAGCAGCCAAAATAATATTTGGGCAGTACCACGATGCACTCATCACCTAGCCCTAATGGATATT
CGCGCGCTCTTTCTTATCGTGCTCTCGCTCTCCATCCGTGAGACCCGAACGAACGTATTGTAGTTCCAGCTCCAGGTCCTCATATTCACATCGTAGCTCA
CGTTTTCCCGATTCGAGCGCCATTTAGACGCAGCAGTTCCGATACACGAGCTTGAATTGTCTCCAGCTGGCGCAGTAGGTCTTCATTAAGCGTTTTCGCT
TCACGAAGTTCTGTTTGCAGCCGGGTTTCCTTCTCCCTGGGCCCTGACGCCTTTGTCGCCGCCTCAAGCTGACCCATGAGTAAGCGCTCACGAGTTTCCA
GCGCGTCTACCCGGCTCTTTAGCCGGCCAACCTCGCTTTGATTGCCACGTTGCTGCTTAAGCTCAAGTAGCGGTAGTTGAGTCTGCTTGTCTTCCAAATC
TTTCTCCAGTTGCTTTCGGCGCTGCTGTTCGACCAATATCTCGTCTTCCAATGAATCTAAACGCTTCCGGAAAGCCTCCCACTTCGTGTTTCGCGCGGTC
CAGTCACGCTCTTTCACTTGCCCGATCGCATTCTCGAGAATTTGGACTTTATCGCTTGACTTTTCACGAACTGTAGATAGCTCCTGGGCCTTTTTCTCCA
TCTCCAGCTCAAGTCGCTGATTTTTCAGGAGTGTTTGTTGTTGCGTCTCCGTTACTAGGTCGTACTGCACAAGGAATTGCTGGTAGGTCGTCTTGATCTG
CATCAACTGATGCTGGAGCTCGCCTACAATTGCGTGATCTTCTGAGGAAGCCATCAAATCACGAAGTCGTTCCTCCTGCTGCTCTAGCTGCCCCACCTCG
TTAATTCTCTCGTACAACAGCGCGTTCTCATTTCGAAGCTCATTGTCATCTCCAGAACGTCCTCTGAGCGGTGGCAACTGCACTAACTCGTCAGAATCGA
CTACAGCCTTTCGATCAGCTACTTCAAGCGTCTTCACGCGCTCCGTTTGCGCCTGTAGCTCGTTCTCAAGTTGATCTATCCGGTCGTGGGGGATATCTGA
ATCGCAACCGGTTTCCCCACTTGTATTTCCTGCACCACTTCTTGCACTCTTTTCGGCTTGAAGAACCATGAGACTATGCTGTGTCTTGGTTAATCGTGCT
GGTAGTTCATACATCGCTAAGTACTTGGCATGCATTTCTGCGTAACTTTCACCCAGTGCGTTGTACTTCTTCAGCACGCCAGTCATTGCACGTTGTTGCT
GATCAGCAAATTCACGAAGCACGCTCTTCTCCAGAGTTTTTTCCATGCGGTCAATCATCTCGTCGGCACCCTGCTTCCACGTCTCTAGGTACAAGACTCG
ATACTTATGAATCTGTTCCGAGTCGTGCAACTCGCCCAGACTGGATATTGGCTGGGTTCCAGCTCGTGGGTGGGGTTTCCTTACGCAGTGAGTGATCGCT
CCCTAACAGCCATTCATAGCCAAAGAATGATGCACGATTTTATCATTGCTGTTCCAGCATTCCACCGCCGTCTCAACATTGTACATTCATTTAATGAATG
CATTTGTGTTGGAGAATGCAATCCAACAAGGACCAATGCAATTGTTGCACCATGCATAATTAATTATGCGCTGTGAGGACGCTGAAACCACAGGCTCGAA
TGGCTATACCTGCTCTAAGAGTTCACACTGACCCAAGTTCCGCAATTGAAATGCCCCGCTTCGACGACAGGTTACCATTCGTTCCCGGGGTGGACTGGTA
GTCTGTCGACCGCTACATAGTGATTCGCACTCGCTATTGTAATGAAACACGATCATTTACATACCCTAGATTCGCGTTCGAGAAGACTGCAAGGCGGAGA
AAGAAGATGTTTTGAAGCAGACAGCGATCACCAGTACTTTCAGCGGATTTTAGTGTCAAATTCACCAATGCCGGGTACGAAGTCTGAAATCCAGAGGCGA
TACGTGAATGTCGGCTATTGTTTGATGAACTTTCGTGTTCACAAAGTGTAGGAAAGTGTAATGCACTTGCGAGGGGTGCTGCTCAGTCCATACATTGGTA
AGGTCTGTCCGTGCAGCTCTCTCAAGTCTAACTGCACGCGTTGTCCTGCAGCCTGCACGCACTTCAACATTGTTCTCATGAACGCAGCATCCGCAGAGGT
GACAAGATGCCCTTCGGGGAATAATGGGTTAAGTGTCAAATTTTACTATCAGATGAAATATAAGTGGCCAATTATCACCAATTGTTTTTACTTTCACGAA
TTTCCCAATTCGAATTTCCGCGAAGAACTTTGCGGAACCACAGCCACTTTTGCCTCGAAACACTCAGCCGCCAAGTTAGAAGCCAAGATGCAGATCCAGA
TCAAGGTACCCACGCCCCCACGCCGCGATCACAGGGGCTGGAAGGGTACTAATAAGTGTGTTTATTGCGCTGGTGTAGACGCTCACTGGCCGGAAGCAGA
CGTTCAACTTTGAGCCGGACAACACGGTACGATGCGATATTCTGGCGCTTCGGACGGTGTGATACTGACGTTGTTTCTCCTTCCGTGAACAGATCCTGCA
TGTGAAGCAGGCCCTGCAGGAGAAAGAAGGTATCCAGGTGGACCAGATTCGTCTCATCTACAGTGGCAAGCAGCTGTACGTGGAGTTAGTCTTGAAACGA
TGAGCTAGACACGGATGTTGATGGCCTTGCTGCTCTACAGAGCCGATGACAAAAATAAAAATACTAAGTATATATAACAATTACTACTAGTAATAGGAAT
GTGCAACTCGTTTTGGATAGTGGATTAAAGTGTAAGGCAAAGCCATCGCAAGAGCGTTGTGGTAAGCATCCACTTTCAAAGTTTCCTTCCATTGAAATTT
TCTCGCCAGAGGTCAGTGAAGATATGATGAAAAAGATAATTTCAGCTCCGATGGATGAAAGAATCACTTGCTTGTGTGGATCATCGATGGAGAGATGGAA
TTTCGCAAAGCACTGCAATAAAGAAAAACATTCGAAGTGGATTAAATCAATGCCATATCCGCAAGATCTTGGGTGGTGGGGCCCAGACTATAGCAAATGG
TAAGCCAGCTATCCAAGTATTATATTTTTATTTTTGATAAATATAAAGTTAGTAATATAGTAAGATGGCGTACTCGTCCGAGCAATACGAACTTAATAAA
GAGCGCATCAAGGCGCTACTATCTAAAGACAAGGGAAACGCGACTGGCGAAGCAGCGAGAATATGATGAGAAGCATCGAACGGAAATTCGTGCTCGTAAG
AAAAAAATATTCAAGCAAGTCGGAACTTAAGCAAATTAACGAAAGCGAACTTAGCTAATTAATTAACACTTTCGCGGTGCAAGGGCGCATTTCTCGCCCT
TTAACGCTGTTTCCAAAACACGGTGACAAATGGACTTCTAAAAGGGCGATTTTTGCGCCCTTTTAGCCTGATCCCGCGCTCGACCTACCGTGTAATATTA
CTACCAATCACAGCATTTTGTTTAAGAGGGATGGGGGTATTTTTCAAATGCTCGCGTCTCCGAGGTGTATTTTATTGCTTCAGCCGCCGTAATCGGCCGC
AGCCGCACCGCCGCGTCATCGACCAAGCGCTGCAAAAACAATGAGCACCAGTATCACCGTGCAGCCAGTCATATCGCCATACATAAGGTAAGTCAAATGC
ACTACATGCTGACTTCATTTCACATACAAAAATTAGCAGAAATGCGCACAAGTTTCACTGACAAAGAAGACAAGCTACTGGTCCAGATCACACTTCAGTT
CGAGAGGGAAGGCCTTCGCATCACCTGGGCATATGTGGCCCGTCGGATGAAAACCAAGCGCTCTGCGAACGAGCTCCGTCTTCGGCTGGCCAGTCTCAAG
AGGACGTACGGGAAGACCATAAGCAGCTTTCCGCGGTGCTTTTTCAGTGGTCTGCCTTCCAGGGGAGTTCTAGTCGCGCGAGCGCGGCCGCCGCCATCTC
TCCTCATTTCCTGGCGACTAATAGCGCCGACGCACGCACCACCTCCCCGTCTCGGCCGCACGCCCTCCACCACAACATCGGCTAGTCTTTCCAACGGATC
AGGCGGTGTTGTCGCCATTGGCACCGACACCAGGTCCTCCTTCAAGTCCGCGAGCAACAGCCCCGACCAGCCCGCGAGCAGCACCGACACCGAGGTCATG
CGCACCAAGTCTGTCCGTGACACCGCCGTCACCAGCTGCCTCGCAGCGGAGTCTGGTGTCCGTGCCGCCATGGACGTCAAGGCCAAGACTTCAGACCGCG
CTGCCACCAAGTCCGTGCGCGGCTCCGTTACCATGCCCAGCCTCTCCGCCGAGGCTGGTGACCGTGTCGGGATCGCCGCCGTAGCCACGTCTGCGGTCAA
CACCACGTCCGAGCCGGCGAGCCACACCATATTCAAGTCTGTGGGCAGTACCACCTTCGCGGGCTGCGTCGCCGCTGAGTCACGTGAAACTATACTCAAC
CCAGGGCAAGCAGCGAAAGCTGTGAATCTCATATTTGCAGGAATCAGTGCGCACGATGTCCGCCAGCAAGCCGGCCGTACTTATGGCAATGCTGGTGAGG
TGTTACCGTCGGGTGTCTCAAAGATACTTGAAGCTGTTGGACCCCTCGGAGAAGCCGACGTTTTCCTCGATGTTGGAGCTGGTGTGGGCAACATTGTCGC
TCAAGTTGCACTTGCGACGAGCGTTAGAACGTGCATTGGCGTCGAGCTTCGAAAGGATCTAGTTGCACTTGAGGTGAAGCGACTTGTCAGTTGGAGAGAT
TGAGCGATTCGGAAGGGACTGATGGCATGAGATCGCGTTTGGAGGAATCGCGATGGAAAGATTGCGGGTGTGTCCAGTTATGGCCAGTTGTGTACAGTGG
TGTCCAGTTATGTCCGGTTGTGTTCAGAAGACATCCACCTCCGGATTGAAGTGGATACATGTCGACCTGATGAGTATGGCGTTATCATTTATGCCGACCT
GACCAAGATCGATATTGAGCAATCATTTCGATACGCAATCTGATCCAGATCGACATGCGACAAACATTTCGATACGCGATCTGTACTCACGATTATTGTG
GGTACAATGGACCAATCTTTTCGACACGGTACCGCGATCTTGGTACATCAGACCAAGTTCAAGCTACGGTGTGCAATCAAGGGATGCGCAAGCGGGATAG
GGAGAAAGCAGGATAGGGAGAGATCTTTCGGGCCTTTACTTTTGGTAAGAGATTCAGATTTGCTTGCAAGACACAAGTGGCGTCCATACTTTCCGGGGAA
GGAATTACATTGGCCTACCCGACGAAGGACCCACCCAGTCGATCAAGGACACGACGCAGACCTGGATAGCTTGGCCAGGGTGCGATCGTACAATCTCATC
TCAACTCAAGACCCCGCCAGAGGAGGCGGCAAGCAACGGAAAGGACTACAACAGCACACCCCCAAGGACACCCCCCACGTGATCGACTTGTCCCAAGACC
CGATCACCAACCACCGACGACCACGTGAAGGATACCTGCGTGGCCGTCACCCACCCATTCCCCGGAAGGAGCAGTCCAGCTGCAACCTCCGCCTTGGTCA
CCCACTGACATCTTCAGTGAACACCGGAAGAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGACTACAAGGTTTTCTGATCACGCCTGATCAACGGA
GTACCCCCTCCGATAGTCGGCAGTCTGGGCCTACCGCTGGCAAGCTCGGATCGCGTCATCGATTTTCGCGATCCCGCTCCGCCACAATGGTGCGCGTGCC
CGGATCTTTTGGTGATTCACAGGGATTTCACCGTGAGTCCACCGAAGAAGATGTCAAGATCAAGACGGAACCAGGGGACGAGACGTCGACGGAAGATGGA
TCGCCGCCGACGGCGCTGAAAGTGCCAGGATCATCTGATCGCAAGAGTGCTGGGAGGAGCTCTGACGATGTGATAGAGGAAGGTTCAGCGATGGACCTAG
AAGAAAAGCCTCCCCCTCCCCTCCCCAGGACCCCCGCGGATCGCGATGCGAATCGCGATCCGCCGGACGAAGATCCGACGGTGAAAACCGAAGGACCTTC
ATCCAAAACCACTCCTCCAGCCTCGTACCCAACCGCGAAGAAGAACAAGTCAAAGACCTCACGCAAGAAGCTGAAGGCACCGGAGTCTGAAGCCGAAGAC
CAGGAGGATCGCAACACGTGGACGGATGAGCAACTGGAGTCTGCCTTCTTCTACAAGGACCTGTACAAGTTCCTGCATGAAGATCCTGTAATGAAGATCG
TGCGTCCCAAGCCAATCGGAGAACTTCAAGGTCCGGTGAAGGCGCCAAAGGAGGTGACCAACTA