Transcript Name :
Phyra_g12105
Orientation:
(+)
Number of Exons:
1
Description :
ABC transporters ABCA family
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ABC transporter-like19.141PS50893
ABC transporter-like17.12PS50893
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain0.000000000018SM00382
AAA+ ATPase domain0.0000037SM00382
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.2730.1611092
InsideOutsideTMhelix
1-130
131-153
154-189
190-212
213-266
267-289
290-308
309-331
332-345
346-368
369-374
375-392
393-443
444-466
467-948
949-971
972-1071
1072-1094
1095-1125
1126-1148
1149-1157
1158-1180
1181-1192
1193-1215
1216-1229
1230-1252
1253-1305
1306-1328
1329-1833
*** None ***
PositionContextScore
188LVLRRRR|PV0.536
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        5501 bases(100 bases per row)
ATGGCAGACGCTGGAGGATCGTCGGACGACGCCGAGAGCGCCACCCTCACGGCGCTCTCCGACTGCGTGGCCACCGTCCTGGAGAACGACATCTCCTACG
GACTGTGCGTCACCAACTCGGGGCTCTTCGACCTGGTGCCGTCGCAGCTCCAGGGCAACAATACCAATGCCTCCTCCTCCTCCTCCTCTTCTTCCTCCTC
CAATGAATTCAACGGGGACTCAGTGTGCCGCATCCTGTGTTCCAAACTCTCGACGTCCGCCTCCTCCTCGTGCTGTGACGCGGCCGCCTCGCTCCAGTCC
TGCAACACGACGTCGTCGGCCGTCACGTCCTGCAAAGAGCTCTTTGACAGCGTCTTCACGTACCAGAACGAGTGCGACGGAGGCCTCTCCTCCGCTAATA
CAATATTAATTGCCGTCGTGGTCGTCGTGGTCGCCGTTGCGGCATCCTTCGCGCTGCTCTCGAGATGCTACGGTCGCAGCCAGGGACTTGCAGCCAAAGT
GGCGGCCACCTGCAGACAAATCGCCAATTTGGTGTGGAAGAACTTGGTGCTGCGACGTCGACGTCCCGTGTCGTTGGCCTTGGAGATCTTACTGCCCGTG
CTGTTGGCCTCAGCGCTCTTGGTGCTGGCCAATCTCGACAACTTCGCGGGAGGGTGGAGGGCCTCGTGGTTCACGTCGGAAGCTGCGGTGCTCGACGCGA
ACGAGACGCTCATTTGCAGCGACGTGGTGGTGTGGGGGCTCGAGACGATTGGAGGACCGTCGTCCACCATGACATCCTTCTTCTCAGGGGGGCAGTCGGT
GCTGGGGCTCTTCTTCTTGGTGAGTTACATCAAGTTTGTGTCCACGACCACGACCACGATGGTCATTGAGAAGGAGAACAGGCTGCGGGAGGTCATGAAG
ATCATGGGACTGTCGGATGCCACGCTGCTCTGCTCCTGGTGTGTCACGACGGCACTGCTGTCGACGCCTTTGGCGTTCGCGATCGCTGCGGAGCTCAAAT
ACGGCAACGTGTTCCCCACGACCGAGTACGCGACGCTCGTGTTCCTCTTCTGGACGCTCAGTGTGGCGATCACGGCCTTCTCGTACTTCGTCGCGCCCTT
CTTCAACAAGTCTCGGACGGCGGCTATTGCGTCCGTGTTGCTCTGGCTTATTCTGTTCTTCCCCTACTTCGCAGTGCAGTCCGCTGATACAAATGGACCG
AGATACTGGGCTGCCTTGGCGCCGCCGACTGCGTTCGCGCTGGCGATAGACGAGATCCTGCGTCGTGCTCAACTCGGGACGGGATTTGCCTATTCTGTCG
GCCTTCGAGAGGAGCCCGTGACAGTGCCAAGCGCCTTCAGAATGAGCCTGTTCCTCATTCTCGACTCCGTCATTCTTGTGGCGCTTGGATGGTACTTGGA
GCAGGTCCTGCCGCAGCAATACGGCATAAGGAAGCCGTGGTACTTCTTGTTCACGAAAAGCTACTGGTTTAATAAGATTGATCACGAACCAGCAAGCGCT
GAGGAGCAAACAACTCCGTCGCTGTCTCCTCAAGCAGGTGGAGTCTACACACAGCTTACTGACGGAAAGATCACGGTCCAGACGCTGGAAGTTGAGCCTG
GAAATGCATACGTGGAGCCCGTCAATGCAACGTTGGCAGTGCAAGAACGCAATGGCACCTGCCTACAGATTCGCGGACTGCGAAAAGTGTTCCCGCTCGA
AGAAGACGGCGAGGAGCACGTGGCTGTTGCTGGATTGGATCTGGCCATGTACAGCGGTCAGATCACTGCTTTGCTCGGACACAATGGAGCTGGCAAGACG
ACGATCATCTCGATGCTGACGGGTCTGATCCCGCCGACGGCAGGAGATGCGACCTTGTACGGGTGCTCCATCAAGCGAGACTTCCACGAGCTGCGGCGCG
TGATTGGTATTTGTCCTCAGCACGACGTGCTGTTTCAGGATCTGACTGTAGAGGAACACATGCTGCTCTTCGGCACGATGAAGCAGGTGCCACGCCACAA
ACTCCAGAGCAGCGTGGACAAAATGATTGAGGACGTTGGACTGACGGAGATTCGGAACGCGCTCGCGAAGACGCTCTCAGGCGGTCAAAAGCGCAAGCTC
AGTGTTGCCCTCGCGTTCCTTGGGGGCAGCAAACTGGTGTTTTTGGACGAGCCCACGTCAGGCATGGACCCATACTCTCGGCGTTTCACGTGGAACTTAC
TCCAGCAGAGCCGAGAGGACCGCGTCATTGTCTTGACGACGCACTTCATGGACGAGGCTGACATCCTCGGCGACCGTATCGCAATCCTGGCTGACGGTCA
ACTGCGGTGTGCCGGATCATCGCTGTTCCTCAAGAACCGCTTCGGTGCCGGATACAACCTGACAATGATCAAGACTTCGAATGGCTCGTGTGACGTACAC
TTGGTGCAAAGCTTTCTCAAGAAGTACGTTCCTGGCGTCAAGTGTCTAAGTAGTTCTGGGTCGGAGCTTGTGTTCCAGTTGCCGACGGCATCGTCAGAGG
CGTTTCCTGCTATGCTCGAGCACCTGGATACTGAAATGCACGAGCTTGGTGTGCAGCAGTACGGCATTTCGGTGACAACTCTGGAGGAAGTCTTCCTGCG
TATTTCCCAGGACCATGACCAGCAGCAAGAGCAGCACGAAGCAGATGGAGAGGTCGTGTCCTCCCTATTGGAGCGAAAACCCTCGGCTTCGGTGGTGGGT
CGTACATCCCTGAAGCTGGTATCGGCAACAGGTGTGGTGAATTTGCCATCGACTGCTCCACCGATCACCGAGCCTACGATGTGGATGCAGTACGTGGCAC
TGATGAAGAAGCGTTTCCAGATTGCCAAGCGTGACAAGAAGACGTTGGCGTACTCGGTGGGTATTCCGCTCATCTTCCTGATCATCCTCGCAATTCTCCC
AGAGATCCAAGTGGCGGACTTCATTCCCAACTACACGTCGAATCTCCCCACGGATGCGCAACAAAGCCAATGCGCTGCGTCAACCAACTTCAGCAGTCTG
GTGGACGCAGATTACAACGTTTCGTCATGCATGAGCTTCCGTGGCTTCGACTACTGCACGCTCGGCGTCATCGACTGCGACGTCAACGTGTGTTGCGATG
CGGCCAACATCGCCTCGCCATGGTATCCGTGCAACACGTGTGGGTCGTCGCCATGCTACAACAACAACTGCCTCGCGAAGAACAACGCGAAGCTGCAAGT
GACACTCAACGGCTTCTTGATAGCGCTCGTTGTGATGTTGGCATTCGCCTTCATCCCTGCAGCTATCGTGGCGTTTGTCGTCCGTGAGAAAGACCCCATC
CAGAACGCCAAGAGCTTGCAGCTGATCAGTGGCGCCAATGTGTCTGCGTACTGGATGGCGAACTGGACACATGATCTCCTGCTCACGATCATCCCGATTG
TGGCTGCTGCGATTATTATCCCGTTGTCGATGGTACCAAGTGGAGCGGCGAATGCTAGCTCCGCCGATGTGTTTGCCGTCATTGTGCTTGTGATCGCGCA
CGTCTGGGCGATTATTCCACTAGCGTATCTGTTTTCGAGGCGGTATGTGAAGCACGCTGTTGCCCAGACGGCGCTGCTCGTGTTCGCCTTGGGCACGGGC
GGCTTGCTGAGTATCTTCTCGTTCATGTGCCGCATCGTCAACTTCACCATCTCGGGCTCTTTGACGCTTTCGTCACTCGACCAGAACTACTTTCGATGGA
TCTTCATGATTTTCCCGGGCTACACGCTGAACAACGGCATCTTCGAGCTGGCCACGCGCAAAGTGAGTCGTCGGGCGATGTTCGGCTCGGCTCGCTGGCT
TCAGGCGTCTCCGTCCTTCTTCGGTCTGTTCGAAGGTTTGGGCAAAGAAGAGTGCATGGAGTGCTGGGACCGAAACGATCCCTCTTGCTGTGTGCGGCAG
CCGTTCGATTTGGAGATTGTTGGCGCGCCGCTGATGTACACGGTGGTCGAGGCTGTTGTGTTGTCTGTGCTTGTGTTCGTGCTGGAGAACCGATCGGTTC
GGTGGAACCAGACTGGAGCGAGCCAAGACGAGAAAGCGGTTCATAGCGCGGTTGGTGTGGATGCTGCCGACACAGCGGACGAAGAAGAGGACGACGACGT
GCAGCGTGAGCGACAACGCGTGGAGCATGAGGCTCCGCAGACGAACGATCTTGTGTTCATTCGTAACTTAAGACAGCAGTACGCTGGCAAGCCGCGAGCC
AAGGTCGCACTGAAGGACTTGTGCCTATCCATCCAGAGCGGCGAATGCTTCGGCTACCTTGGTATCAACGGTGCCGGTAAGTCAACTACGATGGCTGTGC
TGACAGGTCAGCTAGCACCCACACAAGGCTTCGTCACTTTGAGCGGGTTCGATCTGTCAACCAGTTCGGCGGCTGCACGGAAGACCATGGGCTACTGCCC
TCAGTTTGACGCACTGCACGACCTGCTGACCGTGAAAGAGCAGCTGGAGTTGTACGCTCGGATCAAGGGCATTCCCGAGGCTTTCGTGAATACCGCAGTG
GACGAACAGATCCAGGAGCTGGGTCTCTCGAAGTACCGCGACAAGCTCACACAGGGTCTCAGCGGCGGCAACAAACGGAAGGTATCGACGGCCATCGCAT
TGCTTGGTCGTCCACGTGTCGTCTTCCTGGATGAGCCGTCGACAGGCGTGGATCCGAGCTCTCGTCGAAAGATGTGGGACGTCATCGCCCGCGTGTGCTC
GACTGACAAGGATGACAACCGTGATGGCGGCGCCTGTGTCGTCCTTACCACCCACAGCATGGAGGAATGCGAGGCACTTTGCTCTCGAGTGGGCATCCTC
GTGAGCGGGCGACTCAAATGTCTTGGTAGCGTCGAGCACCTCAAACAGAAGTTTGGTCGGGGTTACACTGTGGAAATCACCCTTCGCGCGTTGACAAGCT
CAGTGAATGCCGATAACACGGAGCTGAAGAGTGTGACGGATCAAGTGCTGGCGTTCCTCTCTGCCGAACGGAGTCTGTCAGCACGTCGCAGTGAGAGAAG
CAGTCAACGACAGAGCTCAATCAACACCGCCACCAACGGCGGGGCGAAGGTCACGTCCGCCAACATCCAAGAGCTGTGCATAGTCCTCGGTGCTCCAGAA
CGTGGTAGTAGCATTTTGGACCACACCGGCACAGGTTGGTTGCTTGGCAGTCAGCTGGAAGCGCAGGGTGCGATCTCCGTCGACAGCTTCTGTTCGTGGT
GGGTCTCCGAAACCCACGGCGAGAAGCTGCAGAAGTTTTTCCACGATAAGTTCCCGGGTAGTGTCCTCGCAGAGCAGCAAGGTGAGCACTTCCGTTTCCA
GGTGCCCAAGCTCCGACCGGATAGCTCCGACGGCAGTGCAGCGTTGCGTCCGGCCGAGATTTTCCGCGCGCTCGAGCACACGCGCTCAGACCTCAACGTG
GACGAGTACAGCGTGAGTGAAACTGCACTGGAGCACATTTTTAACAACATGGCGGCGCAGCAGGACGAGGAGAAGGGCGTCGCACACGGCATGTATCAGT
G