Transcript Name :
Phyra_g12109
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_562177
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0370.0519
InsideOutsideTMhelix
1-162
NN-scoreoddsWeighted Score
0.7052.5730.005
*** None ***
TypeScore
cytoplasmic43.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        607 bases(100 bases per row)
TGGTGAAGCCCGTGGTGAACGCCAACATGAACAAGACCCTGCGGGAGGTGGTGGGCCGCTTCGTGGGCGCCAAGCCGCAGCTCTCGCACAAGCAGACGGT
GCAGCGCCTGTACAAGCAGTCGCTCAAGACGCTGGACTCGTGGATCATCGACCGCCGCCTCTGGAACGAGGAGGCTACCAAGATCCGCGCCGAGTTCGAC
GCCAACCGCACGCTGGACGCGGAGTCCGGGTACGTTGAACTTCAAGTTTTGACATTTTTGCAGGGCGCTATGGTTAGTTTGCTGCGATTCCGGTGGTCTG
ACAGGGTATTGTTGATGTTGTTTATGACGGATGTTGATCCGTATGCAGTCTCGCCAAGCGTCTCGTGCGCGAGGCACAAGACAAGGTGGACCACTACACG
CACCCGGACCGCTATATATTCAACTACATGCCTGGCGGCTCGCTCTACATGCGTAACGCGCCCATTCCGCTGGACGTTTGCTTCCCGGACGGAGTGATCC
CCGATGACGTCGAGGTGTCGCCGCTCGAGGCCATCAACATTGACATGACGCCGCTGCCCGCCAAGGAGACGGTCTTCGTGGACTTCTCCAAGAAGGGCTA
CGACTAA