Transcript Name :
Phyra_g12093
Orientation:
(+)
Number of Exons:
7
Description :
pol protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ubiquitin0.000099PR00348
Ubiquitin0.000099PR00348
Profile scan predictionP-Valprediction_id
Ubiquitin domain14.121PS50053
HmmSmart predictionP-Valprediction_id
Ubiquitin domain0.0024SM00213
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
UbiquitinIPR019956
Y-scoreD-scoreY-pos
0.1520.26524
InsideOutsideTMhelix
1-1044
*** None ***
PositionContextScore
903QRARLRR|YA0.685
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        13331 bases(100 bases per row)
ATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGC
CCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAG
CACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATAC
GTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCAC
GCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGAT
AGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCAC
GCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTA
GTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGT
AGGAGTAATTTACTTAAGTTTAGTATCCTTGTATCCGCAAGTATACTGAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTA
TTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATT
GGTAGGAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTGTGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATCCCTTAGTGCATGTTGCAC
TAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACACCCGTCGTCGGAAATGGCAGCGAAGCCAAGCCATTCGTCGTGGGCATCAGCACGAAAAAGCT
CCTGCGGCAAGCGGACCGCGATCCTAGCAGTTTCGTGCTCCATATTGACGCCACCTACAAGCTGACCCAGGTCGGCTACCCGGTCGTCGTTGTGGGCGTG
TCCGATCGCGCGCGCCGCTTCCACCTTCTCGCTATTTTTATAGTGTCGCAACAGAAGGAGCCCCAGTTCACTGAGGTGCTGTCTTTGCTCGCTCAGATCT
TCCTCACTGTGACTGGGAAGCCACTGCGCGTGCGGTGGGCAATGGGCGACGCTGATGCTGCGCAATGGAACGCGCTGCAGGACGTTTGTGGTGGGGACGA
CACGTTCCGCTTCCTGGTGTTTTTTTTTCACGTGGCGAAGAAGATCTACGAGAAGACGCGCGTCCTAGACGCTGGTGTTGCATCAATGGTACTACGTCAC
CTGCATGAACTGCATTTTGCTCGAAGTGAAGCTGAGTTTCGACAGCAACTCGAAGAGGTTCAGGAGGAGTGGCTCAAATTACCTGAACTAACGAGCTTCG
TCAGCTACTTCAACACCGTGTGGCTGAACGAGATGATGTGGAGGTGGCAGTGCTACCACACGCCGAGTGGCTTCGCTGCCACAAACAACCCTGTCGAGAC
GTACAACGCCTCGATCAAGCGTGACGTCACGCTACGCCGGAAACTGAAGGTTGGCGCTCTTCTTGATCGACTCTTGATGCTAGAGCAGCTCAACGCACCA
ATGCCGGTAATATTGCTACTCGAATCAAGCACTAGAGCTTTAGAGGGAGCAGCGGTGCCTGGCGTAATGCTTAGGACATACGATGGTGAGGCCGATACGG
ATGATCCATTCACAGTCAGCTCAACGCACCAATGCCACTAATATCACCGGCAGCTCCTGGAATAAGGGCAACACCAGGTGTCGCTGCCCCTTGGGTAATT
CCAGTTTGATGTATCTGAGTCGATAATCGTTTTTATCGAGATATAGAGTTTGTGCGTAATCGTAGGTGAGGAAACCGCTTGCATCCAGCGTGAGATAGAA
TGCAGGGTTTAGATCGGTGGGGGATAGCTAAAAATCCGTGTATGTTTGTTTTGTCTCAAGCTATATAGATAAAGCTATTTTCAATCATGAGTACGATTCC
AGATTTCGGAGCTTCACTCCCGAAAAAGTTCAAATCAGCATCCATGGGTGATATCCCTGCGCTTGATATCAAATCGCTATTTAGAATGGTTGTGTTGGGT
CCATCGTTCATATATATATACTTCCTCAATAGGCTTGTTCTTGTATTTTCCAAAAGTAAGTTCGAACGACATGGTCTGTTAGTGGTATCTATATACATAC
CCCTTTAATTTTTTTGAGAAAAAAATAATAAATGTAAAACTATCGGCATAATGTTCTACTTCAAGTATTTTTTTATTATTCTTGTGACATCCAAGGTATC
AAAAAACGTTGCGTCTACTAACGTGAAAAACTTCACTTGAATTAATGAGGGGGGGGGGTAATGAGGTCCTCTATTCGTGTTTAACTAGAAACTATAGAGC
CCTGAAAGTCGCTGGGGGCGTCGAAGCCCAATATCTCTGTGGGATTTTAACCCAATGTTGATGTATCGAGGCCGAGGTGAACGGCAGATGAACTTTACGG
AAGCAGGAGGGTCACCAAGGTCTCCCGCCACGGTGGATCACGATAATCGTGCAACACGAAGGCTCCACCAAGTCCTCCGCGTTTTGGTGGGCAGACTTGA
ACACTTGAGGGTCACCACGTCCTCAGTGGTTTGGTGCTGGATCAGAATCGCTACGGGGCACCAGGTCCGTCGCGATGTGGTGGGAAATCTTGATCACGGG
AGGGGTCACCATGCCCTCCGTGCCTTGGTACTTACTTGAATTAATGATTCGCACGGTTTGCTCTACGTCGAGCTCTAGCTCTTTCAGCACGGTGCCATTC
GGCATGAGCAACATGTTCACCAGCACTTCGGAGTAGTCTTGTGCACGCTGGATAAGGACACACGAGATCAACTTCTTCTTCCGATGACGATCCGGATTCC
TGGTCCAACACAGCGTCCAAATCTTCACAATTAACAGTGAAGCCAGGAAGAACGGTACCACCATCAAGATCTCTCCACGCGCTATTGCCAACGCGTCGAA
CAAGACAATTTCCTCGGGCGCATCGCTTGTATTCGCACATGATTTTGTTCTTTGGATCAATGAGCCATCCCAATTGCACACCGTGAGGGAAGTACTCGTG
CCGCATCTTGTGATCGAGAGCACCAAGCTTGGAATGTGAACCAGTGAGAGTGTCGATTTCCACCACGAACGTCGGAGCAAAAGGTTCTCCACCACGAGTC
CATCGTTGAGCTTCGGTCAGCTGCCTTGCATCATCTCGAGGCACATACGCCACATCGGGGACCCGAAGCGTTGTGCCATCCAGCACGTATTCATCTAGCG
CATTTGTCACTCTTCCACCATGGCCACTCCACGCAGCCCAATTCAGCAGTGCCTTGCAGATGCATGGTCCGATTACGCTGCGCCCAAACACCACCATCCG
AAATGGAATAAATCGGCCTTCGTCGACGAAGAAACCAGGCTGCTCGCCAAGTATTGGATGGACCAACGGACCGAACTTCTTCACGTGCTGGTTTAGCTGC
TCGAGGGACACACCAGCGTAGTCCTTGACACGGCACAGAGTCTTCTTCGACTCTAGGTCACGCACCAGTCGCGCAAGCACGTCTTCGTGGTCTTTCTTCT
CGCCGTTTGCTGCGGTCATGGTTGCCGATGCTGTTCTTCCTCGCACTGGCAGAAGCAAACAAGAAAGACCTTGCCCAGTGTGGTCCACGCTACGAATGAA
TTGACTTCAAATTGAATTGGTACTTCCACTAAAAAAATGATCAATTCAAATTTGATTCATCAGTGACGGTTCCGAGAACTAGTTCCATACCCAGGAACCG
ATAGGTAACCGCGGCATAATCCGACGCATAATCATGTCGGCAGACCTCCGATCCTCCACGTTGCTGTTTAAATGGCCCGGAAAGTCGGAAAGTGGGCAAT
TCGCGCTCCACTGGAGGCCAAGTTGCCCGACATTTGACTTTCCGAGCCAAACAAACAGCAGCCAAAATAAATATTTGGGCAGTGTCACGATGCACTCATC
ACCTAGCCCTAATGGATATTCGCGCGCTCTTTCTTATCGTGCTCTCGCTTCTCCATCCGTGAGACCCGAACTAGCGTAATTGTAGTTCCAGCTCCAGGTC
CTCATATTCACATCGTAGCTCACGTTTTCCCGATTCGAGCGCGCCATTTAGACGCAGCAGTTCCGATACACGAGCTTGAATTGTCTCCAGCTGGCGCAGT
AGGTCTTCATTAAGCGTTTTCGCTTCACGAAGTTCTGTTTGCAGCCGGGTTTCCTTCTCCCTGGGCCCTGACGCCTTTGTCGCCGCCTCAAGCTGACCCA
TGAGTAAGCGCTCACGAGTTTCCAGCGCGTCTACCCGGCTCTTTAGCCGGCCAACCTCGCTTTGATTGCCACGTTGCTGCTTAAGCTCAAGTAGCGGTAG
TTGAGTCTGCTTGTCTTCCAAATCTTTCTCCAGTTGCTTTCGGCGCTGCTGTTCGACCAATATCTCGTCTTCCAATGAATCTAAACGCTTCCGGAAAGCC
TCCCACTTCGTGTTTCGCGCGGTCCAGTCACGCTCTTTCACTTGCCCGATCGCATTCTCGAGAATTTGGACTTTATCGCTTGACTTTTCACGAACTGTAG
ATAGCTCCTGGGCCTTTTTCTCCATCTCCAGCTCAAGTCGCTGATTTTTCAGGAGTGTTTGTTGTTGCGTCTCCGTTACTAGGTCGTACTGCACAAGGAA
TTGCTGGTAGGTCGTCTTGATCTGCATCAACTGATGCTGGAGCTCGCCTACAATTGCGTGATCTTCTGAGGAAGCCATCAAATCACGAAGTCGTTCCTCC
TGCTGCTCTAGCTGCCCCACCTCGTTAATTCTCTCGTACAACAGCGCGTTCTCATTTCGAAGCTCATTGTCATCTCCAGAACGTCCTCTGAGCGGTGGCA
ACTGCACTAACTCGTCAGAATCGACTACAGCCTTTCGATCAGCTACTTCAAGCGTCTTCACGCGCTCCGTTTGCGCCTGTAGCTCGTTCTCAAGTTGATC
TATCCGGTCGTGGGGGATATCTGAATCGCAACCGGTTTCCCCACTTGTATTTCCTGCACCACTTCTTGCACTCTTTTCGGCTTGAAGAACCATGAGACTA
TGCTGTGTCTTGGTTAATCGTGCTGGTAGTTCATACATCGCTAAGTACTTGGCATGCATTTCTGCGTAACTTTCACCCAGTGCGTTGTACTTCTTCAGCA
CGCCAGTCATTGCACGTTGTTGCTGATCAGCAAATTCACGAAGCACGCTCTTCTCCAGAGTTTTTTCCATGCGGTCAATCATCTCGTCGGCACCCTGCTT
CCACGTCTCTAGGTACAAGACTCGATACTTATGAATCTGTTCCGAGTCGTGCAACTCGCCCAGACTGGATATTGGCTGGGTTCCAGCTCGTGGGTGGGGT
TTCCTTACGCAGTGAGTGATCGCTCCCTAACAGCCATTCATAGCCAAAGAATGATGCACGATTTTATCATTGCTGTTCCAGCATTCCACCGCCGTCTCAA
CATTGTACATTCATTTAATGAATGCATTTGTGTTGGAGAATGCAATCCAACAAGGACCAATGCAATTGTTGCACCATGCATAATTAATTATGCGCTGTGA
GGACGCTGAAACCACAGGCTCGAATGGCTATACCTGCTCTAAGAGTTCACACTGACCCAAGTTCCGCAATTGAAATGCCCCGCTTCGACGACAGGTTACC
ATTCGTTCCCGGGGGTGGACTGGTAGTCTGTCGACCGCTACATAGTGATTCGCACTCGCTATTGTAATGAAACACGATCATTTACATACCCTAGATTCGC
GTTCGAGAAGACTGCAAGGCGGAGAAAGAAGATGTTTTGAAGCAGACAGCGATCACCAGTACTTTCAGCGGATTTTAGTGTCAAATTCACCAATGCCCGA
GAGTACGACAAGTCTGAAATCCAGAGGCGATACGTGAATGTCGGCTATTGTTTGATGAACTTTCGTGTTCACAAAGTGTAGGAAAGTGTAATGCACTTGC
GAGGGGGTGCTGCTCAGTCCATACATTGGTAAGGTCTGTCCGTGCAGCTCTCTCAAGTCTAACTGCACGCGTTGTCCTGCAGCCTGCACGCACTTCAACA
TTGTTCTCATGAACGCAGCATCCGCAGAGGTGACAAGATGCCCTTCGGGGAATAATGGGTTAAGTGTCAAATTTTACTATCAGATGAAATATAAGTGGGC
CAATTATCACCAATTGTTTTTACTTTCACGAATTTCCCAATTCGAATTTCCGCGAAGAACTTTGCGGAACCACAGCCACTTTTGCCTCGAAACACTCAGC
CGCCAAGTTAGAAGCCAAGATGCAGATCCAGATCAAGGTACCCACGCCCCCACGCCGCGATCACAGGGGCTGGAAGGGTACTAATAAGTGTGTTTATTGC
GCTGGTGTAGACGCTCACTGGCCGGAAGCAGACGTTCAACTTTGAGCCGGACAACACGGTACGATGCGATATTCTGGCGCTTCGGACGGTGTGATACTGA
CGTTGTTTCTCCTTCCGTGAACAGATCCTGCATGTGAAGCAGGCCCTGCAGGAGAAAGAAGGTATCCAGGTGGACCAGATTCGTCTCATCTACAGTGGCA
AGCAGCTGTACGTGGAGTTAGTCTTGAAACGATGAGCTAGACACGGATGTTGATGGCCTTGCTGCTCTACAGAGCCGATGACAAAAATAAAAATACTAAG
TATATATAACAATTACTACTAGTAATAGGAATGTGCAACTACGTTTTGGATAGTGGATTAAAGTGTAAGGCAAAGCCATCGCAAGAGCGTTGTGGTAAGC
ATCCATTTTCAAAGTTTCCTTCCATTGAAATTTTCTCGCCAGAGGTCAGTGAAGATATGATGAAAAAGATAATTTCAGCTCCGATGGATGAAAGAATCAC
TTGCTTGTGTGGATCATCGATGGAGAGATGGAATTTCGCAAAGCACTGCAATAAAGAAAAACATTCGAAGTGGATTAAGTCAATGCCATATCCGCAAGAT
CTTGGGTGGTGGGGCCCAGACTATAGCAAATGGTAAGCCAGCTATCCAAGTATTATATTTTTATTTTTGATAAATATAAAGTTAGTAATATAGTAAGATG
GCGTACTCGTCCGAGCAATACGAACTTAATAAAGAGCGCATCAAGGCGCTACTATCTAAAGACAAGGGAAACGCGACTGGCGAAGCAGCGAGAATATGAT
GAGAAGCATCGAACGGAAATTCGTGCTCGTAAGAAAAAAATATTCAAGCAAGTCGGAACTTAAGCAAATTAACGAAAGCGAACTTAGCTAATTAATTAAA
AAAAAATCTCGGATATAATGTAACGGGGTTACCTGAAGAGTGCCCGTCACTCTTCCGAGTTGGGTACATGGTGTACCCAACATCACTGACACGTTGTGGT
GGCTCACAGCCACCCATACATAAAACATATAGGATAAACTATAGTTGAATTAGGAATTGTATTGCAAGACAATCTCTAGGTAACTAACTATAAATATATC
AGTCTATAAACTACGTTGTCTAAGTCAACCGTTCCCCAAGACCGGGAACTAGTGAACCGCCGTTCACTTGGAGTTTGTATACTCCTAACACTTCCTCAAG
CGCAAGGTGCTGTGTGATTCCGTCACACTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAGGATTGGACTACCTGAATCCTCTGTGGTCTCAAG
CATTGAGCCACCATGGATCGCAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCTTCGGGATGGATACCCTCC
AGAGCTTGGCGGCAGCAACACCTGCCGAGCGGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGTTAATCGCCCATGTACGTGGGAGCCTACA
GGCCCCTGTGGCTGAACGGAAACCAGTTCAGCCCAAGTCTTTGAGGCTGAAGGTTAACCTCTACGAAGGAAAAGAAGGGGGAAACCTTCACTTCTGGGTT
CGAGAGGTCGAGCTCGCTATGGACACGGCTCTCGTCTCGGACGAGCCTCCGCGTCGCTTTTGCTCTCTGACAAACTATAGTGGTCGAGCAAAGTGCTGGG
CGTAAGACAATCTCTAGGTAACTAACTATAAATATATCAGTCTATAAACTACGTTGTCTAAGTCAACCGTTCCCCAAGACCGGGAACTAGTGAACCGCCG
TTCACTTGGAGTTTGTATACTCCTAACACTTCCTCAAGCGCAAGGTGCTGTGTGATTCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTCGCCTACGC
GGGTAGGGATTGGACTACCTGAATCCTCTGTGGTCTCAAGCATTGAGCCACCATGGATCGCAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCC
GTTCGGAAGATGGCGGGCATCTTCGGGATGGATACCCTCCAGAGCTTGGCGGCAGCAACACCTGCCGAGCGGCTCGAGCGCGTAAGCGCTTTCGACACGT
ACGAGCAAGGGTTAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTGTGGCTGAACGGAAACCAGTTCAGCCCAAGTCTTTGAGGCTGAAGGTTAACCT
CTACGAAGGAAAAGAAGGGGGAAACCTTCACTTCTGGGTTCGAGAGGTCGAGCTCGCTATGGACACGGCTCTCGTCTCGGACGAGCGACTCCGCGTCGCT
TTTGCTCTCTCCCACCTTAGTGGTCGAGCAAAGAGCTGGGCGTATACGCGCGAAGCGACAACGCCTGGATGCTTTGCATCCTGGGCTCAGCTGTGTGAAC
AGCTTCGAGCCGCCTTCCTCCCGGCGAACTATGAGTATCGCCAGCGCTCACAAGCAAGGGAGACGTGAGCTGCACGAGTACATCTTTAGGCCCAGCGCGC
ACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAAGAAGCGATTCAAATTGCTCTTCAGGAGGAGTACAGCCATCGACAGGCTCGCACTCCTGCCACTG
CGTGGCTTGGGGGCTCCACTCAGGGCGGGCCCCAAAGTAGGGGCCCCTTCAACGGTCCTGTGCCGATGGACCTGAGCCTTGCCGAACAGCACGACATGCG
CTGTTTCGGCTGTGGCAAACTGGAGCACATGAAACGTGCGTGTTCCGCGGGAGGAACAACCCGGCGGTTTCCTTCCAAGCCCTTCGGTCCTAGGGGTCGC
TGGCAAAAGCCACGACCCCGTGGCCAGGGGAACGCAGGGAACCAGTAGGGGCGGGGAGCCCTACTGGGGAAGATCTAAGTCTTCATGAGTGGTGCGCACC
ATGAGGGCTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGAGGAGGGCTGCTTGTAGTACATGCAAATGTACGGGGATACGATCATCC
CATGAGAATCTTGATCGATTCTGGGGCGTCAAAGAACTTTGCACGCCGCCGGACGGTCGCTCGCAAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGC
AAAGGGAACGGGCATGTCCTAGTCAGACTGGCTGACGGGACTGTAGTGGAGGTGCCCAAGGTCTTTATGGACCTGTCCGTCAAGTTTGAGGACTTAATTC
CACTGAACGATTCCTCGTTCTTGATATGGACAAGTACGACTTGATCCTGGGCATGCCATGGCTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAA
GCCATCGGGGCTAGCCGGCCTGTTGCTACTAACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCAGAA
ACGACTCCGAAGAATTAGTTGCGGCAGGAGCCGCAACAGGTGTCATGACACCGTCCACGGCGGGCAATGGGCCGCCACAGGCAATGCCGGTGGACAGGAC
TTCGAGTCCAGCGAGGGGAACTGCAATGCCAGCAGTACCCACCGCTCCTGACTATGGCACCGTACGGCCTTCGGCCTTGTCGACGCCGGGGGAAGTCAAC
TCCCCAAGGGAAGCGAGCCCACGTGAGACCAAGGAGGTCGAGACCGTAGCCAGGGTCGAGGTTGCTGGGAGCACCTCTAGTGCGGGTAACAATGTACCAC
ACGGAGTCGATGGAACTCCCGACTCCACCCTTGAGTCACCACCGGCTGTGGGTAACAAAGGACCACGCCGTGGTGGGCATCAACGACGTCATCGCCGCCG
TAAGCTGAGTCTGTTGAGACAGACTGGAGTCGCTACAGAGAGAGAACTCTCCTCAGGCACGGCCGGCCGAAGAATTCTATCACTTCTTCGACGGCGAGAC
CGGGTGTACGGTCAAGGCGGACTCCACAACATTGGCAGCTCTGCCTGAGGTGTCCGAGCTACTGAACCTCGAGGAAATGTCGATGGACGATTTCCTGGCA
CAATTGAAAGCCGGGGCAATCGCGGAGATGGTGCTCCTGAAGCCGGAGGCCTCTCCAGAAGAGCTGAGCTCCTCTTCCGTTATGGACAAGGATGTCCTGG
GCGAGCTTGGTAAGAAGCGCGCAACGCGTACGGGCTCTGCGATCCTCGAGAACCCCAAGGATCCAGTGTATCCTTTGGTGAAGGAGTTCTCGGACGTGGT
GTCCAAGGACCCGCCGTCCCAACTCCCACCTGACTGAGGAGTTAGGCACGAGGTTGATCTCGTGCCAGGCACAAAGTACTGTGTGACCAGGCAATGGTCA
CTGCCTCACGAACAGTGCGAGGTCATTGATGCCTTCTTCGTCGCGAAGGCAAAGGCAGGCATGGTGCATGAGTCGAAGTCTCCGCACTCGACGCCCACCT
TCTGCGTTCGCAAGCCGAACGGGAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCAACGGTGCCCGCCCAGACACCCATCCCTCGCAAGGA
TGTGTTGCTGAACAACATGGCGGGCTGTGAGCTTTTAAGCGCGCTGGATCTGGTGGATGGATACTACCAGATCCTGATGCGCGAGCGCGACATCCCGCTC
ACGGCGGTGAGCACCCCGAACGGCATGCTCTGGGAGTGGCTAGTGATGACACAGGGTCTATCAAATGCCCCAGCGACTTTCAATCGCTTGGTCACACAGT
TGTTTAGACCCTTGCGTGCGTTCACGCAGACGTACTTTGACGATAACTTCGTCCATAGCCGTGCCGAGGAAGGCAAGACGGCTATCGAGGTGCATCTCGA
GCACCTCCGTCGAGTGTTCATGGTCATGAGAGCAAACAAGCTCTATGCCAACATCGACAAGTGCGTCTTTGCGGCACAAGAGATCAAAGTTATCGGCTGC
TTCGTCAGCAGCGTCGACGTTCGAGCCGACCCTGAGAAGGTCAAGGCCATTGCGGCCTGGCCCACACCACGATCCCAAAAGGATTTTCGCAAGTGGTTGG
GCCTCGCCAACTACTTGCACAAGTATAGTGCGGGGTATGCCGGGCTGGCACGACCCCTGTCGGATCTCCTTAAGAAGGATGCCGACTGGCGCTGGGAGAA
CCGTCATCAGGATGCATTCAACAGCATCAAGGCGAGCTTGCAGTGCGCGCCGGTCCTGGCCTTGCCGGACGAGACAAAGCCATTCAGCGTTGTCTGCGAC
GCCTCCGACTATGCCATCGGTTGCGCGCTGCTGCAACACGACGCGGACGGGCACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTTAAAGCTGCCGAGA
GGAACTACCCTGTCCATGACAAGGAGCTCCTCGCAATGAAGTATGCCCTTGTCAAGTTCCGGGTACTCCTCCTGGGCTCTGAGCCCTTTGTGATCTATAC
AGACCACGAGTCCTTGCGGACGGCCACCAACTCTCCGCATCTGTCTCAGAGGATGGCCCGCTGGCTGTCATTCTTCGCGGAATATAACTTCCGCGTCGAA
TACAAGCCGGGCAAGCTGAACGTGCTTGCCGACGCGTTATCACGTCGACCCGACTATGAGCTCGCGCACATTAGTCGGGTTACGACAGATCTGTACGATC
GGATACGCCTGGCATATCGAGATGATGATAATCTCTCTCCCATCGTGCGGTTCCTCACCGCTGGCAAGGAGGTCAAGCCTGCATGGCTAACGCCCCGCCA
ACGTGCCCGACTCCGTCGCTATGCGTGGGTCGATGGCCTCCTCCACTACCGCGTGGACCCGGCCAATCCTCCGCGGATAGTCGTCCCCAACGAAGAGGAT
CTGAAGTATGACATCCTTCAGGAGGCGCACGATGTGCCTTCAAGCGGCCACCTTGGCCGCGAAAAGACCTTCTTGTCGGTCTCCCAGGTCTTCTGGTGGG
CCCACATGTACAAGTGGGTCGTCACGTATGTGAAGGCCTGCGAGACATGCCAGCGTGTGAAACCTGCTGGTCATGCCTCGGCTCCTTTGCAGAGCCTGCC
AGTCCCAGAAGACTGCTGGAAGTCGATGAGTCTCGACTTCGTCTTCGGACTGCCGGCTGATGCCCAGGGCAACACCGGCGTCCTGGTGTTTGTCTGCCGC
TTGAGCAAGATGGTACACCTTGCTCCGGTGGCTGACTCCGTCACCGGGGAACAGACTGCAAGGCTGTTCCTGGATGGCGTCTTCCGCTATCATGGCCTCC
CTGAGACTATTATCTCTGACCGTGACCCAAGGTTCACGTCTGCGTTTTGGAAAACGCTGTTCCACTTGCTTGGAACACACTGCTCATGTCCACGGCCGAC
CGCCCGCAAACAGACGGCCAGACGGAGCGCGTCAATCGCGTCCTCGAAGACACTCTACGCAGTGTCTGTGCCGAATCTCCCGGCACATGGTCGGCCAGTT
TGCCGATGGTTGAGTTTGCACTCAACAACGCGGTACACGCGTCCACGGGGTTCTCTCCGTTCTACCTCAACGGGCTCCAGAACCCCCTGGTGCCACTCAC
TCTCCGTGGTGACACCGTGGCTTCGGTCGTAAGTGGGGGAGAGGCTCGGAAAGCTCTATCCTCCCAGGTGTCAGAAGTGACACCGGCTTCCCTAAAGAAG
CAGTTGTCGACTTTTGTCGACAACAGGCTTA