Transcript Name :
Phyra_g12096
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase C12, ubiquitin carboxyl-terminal hydrolase 10.0000049PR00707
Peptidase C12, ubiquitin carboxyl-terminal hydrolase 10.0000049PR00707
Peptidase C12, ubiquitin carboxyl-terminal hydrolase 10.0000049PR00707
Peptidase C12, ubiquitin carboxyl-terminal hydrolase 10.0000049PR00707
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7590.86120
InsideOutsideTMhelix
1-4
5-27
28-84
85-107
108-127
128-150
151-198
199-216
217-220
221-243
244-675
NN-scoreoddsWeighted Score
0.7121.8290.004
*** None ***
TypeScore
endoplasmic reticulum44.4
GO
Biological ProcessGO IDPrediction Method
obsolete ubiquitin thiolesterase activityGO:0004221IEA
intracellularGO:0005622IEA
ubiquitin-dependent protein catabolic processGO:0006511IEA
*** None ***
*** None ***
Sequence
        5340 bases(100 bases per row)
TGAAGTTCAACGTCTTCCTCCTCGCCGTCATCGCCATGCTCGGTATGATCACCGCTGCTACTGTCGACCAAGGTGCCGTCAAGACTCCCGCGGAAGCGCT
GGAGAAGATTCAGGCCTCTGACTTGCCTGCTGGTGTCACGCTCACGGGGACGACCGAGAAGATAGACCCACCTGCTTCCGCTTCAGCTGTCGCTATGAAG
GAATCCGACAAGGATGACAAAAAGGAGCAATTCGGCTGGGGCGTCGGTGGTCTCGGTCTCGGTCTCGGTCTTGGTGGTGGCTGGGGGCTTGGTGGTTGGG
GAGGGTGGGGTGGCTGGGGAGGCTACGGACCCTACCGCTTCGGCTTCATGTGCGGCGGCTACCCTGGCTGGGCGTACCCGATGGGCTACTGGAACATGTA
TGGTGCTGGTCTGTACGGCGGTGGCTGCGGTCTGGGCATCCCATTCGGCGGTCTCTACTACTGCTAAGTTTTGGAGAGAAGGCTGCTGTCAGCCAGTCGA
CATTGAACAACTGGTGGGATCATTCTTTAAGAGTGCGGTTTATCGCTTCGCTTCACGTTTTGCTAAGCCCATGAAATAAGCAACACCCACTTTCTTTCTT
GCCTACGACTTTAATGTACGAGAAGTACGTCGTGAAGGCATACACAAGGTGATGCATTCTAGTTTGATCTCATTTTGATCTACAATTTCCATTTGGGACC
CAGAACGAAGCCGTCTACTCTTTCTACATGTATTATATGATACTTGCTATGTACTAAATGCAAGACAATACCTGTCTGGCAGGCATTCCAGAAGAAATAT
TGGAGCAGTGCGGTTTGAACGCAGAATATTAAAAAAAGACTATTGGTATTTTCATAAGAAATAGTATTATTTTAGCAAACTCTAGACGCTTCTCATATTT
TATGTCGATAGTGCAAACAAACTGATATGATATGTTGGAGACGGGGTCTCTTCATGTACCGCATTCAGCTCCAACGCTGTCTACGATGGCGTTCTATTTT
TCTAAAGTGAACAATGAACCCTTGTAGTATTTGATAACTTGGAAGCGAGTAAATTCAAGCCTCAAGCTGACCAAATGGTTTATTGTTGCGCTATCGTGTT
CAGTTATTTGGATGGCGTGGATTGCACGAGCTATCTTTTTATCTTCATGCTTCCAAATGCCATCGCAAGATTAAACTGTTGAATGAGTGAGCACAGAAGA
CGCTTCGTTGCTGTTGTTACCATAGTCGAGGAGGTACCCCGTGAACACAATTGTCTCGACGGGGATGCAGTATAGTCCGTTGTACTTCATGTAGTCAAAG
CCCTCACAATTGTAAAGCATTTTCTTGAAAGGAGGGAGTGAGTGGCGAGACAGTTTTATTTACCAATGGTGGACGATTATCGCCGGCAAGAACGCAAGCT
CAGAGACGCTTCGTTGTTACCATAGTTGGCGTACCCCGTGGACAAAACTGTCTCGACGGTGATGCGGTATTTTCCGTTGTACTTTACGTACGAAGAAATA
GGAGAGAGTGCCGAGACACGTTTTAATATTAATGGTGAATTTGGGGTTTCAAGTGCTGGATCGATTTCCGTTAATTAAAACTTACCTCAGAGACTTCACT
ACGAGCGACGACGTCACGGCAGCAGCCCCTAGCATCATAGACGCAAAGAAAATAATAATAGGTATGATAAAGGCGCAGTATTATTGTGCATCAAGCTCCC
AGATCTTTCGCAAAATTTGAACGTTCATCTTAATGGTTAATTCGAGCGGTGCGCTCCAACGATGTGTGAACTGTATTTTGGGAGCGAGCTCAAAGAGGGT
ATACCTCCTTTTATATCGCGCTCTTTCGCAAGAAACTCACCTCGCAAGCACCAAGAACTTGATGCGCTTTTTGGGGGCTCTATAGTCTCTAGGTAAACAC
GAACAGAGGACCTCATTAACCCCCCCCCAAAAAAAAAAAAACTTGATGCGTTTTCGTAGCTCCAATTACCTTTGCTTCCATTTTGCGATCTACTCATCCA
AACTCATTAGTAATTTTTGGGTGGCGTTTGATTAATCCACCCGCTGTACGGTAAATCCCCACTTCCTGAACTAAACACATTGCGACTCAAAGAAATTGGT
AAATTACGCAGGTCTGCGATCCCATATTATATTTTCTTGAAACCTTTCGCGGTTTGATTTTTGGTGGATCTAGTGTTGGGGTCTTTGTAGGAAAGAAGTA
AGTGTAATTGTAGCAATGAAACGCACCAAGTACTTGGTTACTTCGCAGTAGTTTCCTGCGACAGAGCTCGATGTTTCAGCGTCCGCCCCCAAAATACTGT
TCATGTAGAATCAACTTCACCTCAGGTGAGTTTGGAAACGTTCCAGGAAACTCAGCTCAGCCAAGTGTTATTAAGTCTGGACGCATACTCCGATACAAGT
GCGCTTGGCCCCACTCATTTCATGTCACGCTTCAACCTTCAGTTTTCATTTCGTGGTTTACTGAGCAGACGCCACGCGAAACTCGCCTACAACACCCGCA
GCGATCGAGAGATGAGTATCGTGACTCCTGTCGATGTTGCGGTTGCTGTTGGTGAAAACGACCCAGGGTCGCCACTGAAGACGTACACGTTCTACAACGT
AAAGGGGCGCGACGGCAAACTCGCCACAGAGATTTCAGTTACCTTTAACAACGACTGGGCTCCATATTGGACGGATGATCGTCGTGTGTGCCCACCCCCG
CCGGACCCGACGCTGTTCACCACGATAATGGGCATTATCTGCTTACCAATTGCCCTCGTGTTGCAGCTTGCCAAATACATCGTCATGGGCATTTTCGCGA
TCGTTGCCGGTATTTTGTCGGTGCTCTGGATGCCAGTCACTGCTGTCAAGAATGCGTGGCGGTACGGCAAAGCGCCGCCAGTACTCACCCTCGATGAATT
TCATTACTGGCTGGGTCGGAAAGGGTTTACCAATGAGGAGATGAAGAAGGTGAAGGAAGCGACCAACGGCATGACGATGCACACACTTGCACGCACACTG
ACTGATGTGCGGGATGTGGAGAAGCTATTCAAGTTGCAGTCGATCGAAAAGCAAAAGTTGGTGGTCGGCATACTTCAACAGTCCAAGGAGGCAATTGACA
AGGCACATGAAAGCAAGTTTCAGGAACTCCGGAAACGGTACACAGGCGCGATCTTCAGCTGGGGGGCCGAAGACGCTTACAGACTAGGCGACGCGATTGC
CAAGAACGGGCGAATGTGCAGTCGAGGTGAAGACGCTCGCAAAAAAGCAGACTGGCAACAACGGGTTGCCTCCAAAGTCAACTTGCGAGTCAACGCAATC
TTGCGCTGCATCAACACGATTGCGAACGAAGGTCGTTTCTCCTCGAACGACGCGAAAATGAGTGACCTGGAGCGGACTGTGAATCGATCCGATAACCCAC
CGGATTGGAACGAGTTTGTGGTCGACAACAAAAAACATGACAACAAGTTGTTCGACGAAATTCACACTGCAGCACCTTACATCAAGCAGTACATTGCGCA
GGCAATTGTCACCGAATCGTACGCCAGGCGAGTAGCACGTATTTGCTGGAGCTGGACAGTTTTGTTGGTGCTTGTCGCCTTCCGGCTGGCCAAAGTGGTC
CTTAGATTCGAATTCGATGAAATTGGCGATGTGATCGACCTCATTGTCGGCACGGTGACTGAACTCGCTGAATCTCCAATGGATGCCTTGGACATTCTCG
AAAATGGACTGCCGACAGGCAGCGGAGGTACTGGCACCGACGGGAATGGTTTGGGAGGCTCGATAATGAACGTGGTTGACGACAGATTCGGCCGGGACGC
ACGCCTCGAAAACAAGGAAGCGCAGATGAAGGCATCAATGAAGTGTGAAAAGGTGACCGAGCTCGTCGAGGAATAGAGACCCGCAGTCTCGCCATCGAAC
GGTAATTAGGATTCGAACAAGCTTCAGCAGTCCAATGCATCTGAACTTCGCAGTCTAGACTGACTTGAGGAAAAACATTATAATCGATTTCTATTCAGCA
AGCATTTGTCCTGTGTTTTCAACATGCGGTTTAGCGAAACGTTTGTCGGTCGAAGGCTACATTCGTTATCCCTGGATAGATTGAGTGACGTTTTTCGTGA
CCAGGGCCATATCTCGAGAATAGGCAGCACAGCCGCAATCTCAATCTGAATGGCGCAAATGAGACGCAACAGCGTTAAACGTCAAACCCCAGACTCAATA
ACAACGGTGTTGGTCGGGAAAACTGCACCACAAAGAATATCATGACTTCAACGTCAATATTTCAGTTATTGTTCGAATCCACCGTTACGAACCTGCTTCA
GTGATCTTTTTGACCGGAAACACAAAAATGTCGTGGTGTACCATCGAGTCCGACCCCGGTGCGTCTCTTGTTGCCCCCCCAATCCACCGGCCACGCTAAC
CCCATCCTCCACTGTAGGTGTGTTCACCGCTCTCATCGAGGACATCGGCGTCCAGGGCGTCCAGGTGGAGGAGCTCTACTCGCTGGACGAGCAGCAGTTC
GCCGCCCTGTCGCCAGTCTACGGCCTCGTGTTTCTCTTCAAGTACGAGGCCAAACACGGGGAGGAGGCCGATCCCCCGGTCTTCGCCTCAGAGGAGGACG
GACTGTTCTTTGCCAAGCAGGTGATCAGCAACGCCTGCGCTACGCAGGCCATCCTGTCCATCCTGCTTAACTGCCAGGGCCTCGAGCTGGGCGAGACGCT
GACCGAGTTCAAGGCCTTCACGAGCGACTTCCCGTCCGAGTTCAAGGGCCTCGCTATCTCCAACAGCGACAAAATCCGCCTCGCCCACAATTCTTTCGCC
AGGGCCGAGCCGTTCGTCGTGGAGGAGAGAAAAGCAGCCACGGAAGACGATGACGTGTACCATTTCGTGGCCTACGTGCCTGTGAACGGCAAGGTCTACG
AGCTGGATGGCCTGCGAGATGGACCGATCTGTCTGGGGGGCGTTCCAGAAGGAGACAACCGTGAAGCGTGGCTGCAGGTGGCGTGCCCCGTTATCCAGAA
GAGGATCGAGAAGTACGCGGCCTCGGAGATCCGCTTCAATCTTCTGGCGCTCGTACGCAACCGGATACAAGCGTTCGAAGAGCAGCTTGGAGCACTCATT
GAAGCTGGTGGTAGTGAAGAGCTGGCCGCGCAGATCCAGGCGGACCTGGCCGCAGAGCAGCAGAAGCGAAATGACTGGGCGCTGGAGAACAGGCGTCGCA
AGCACAACTACATCCCGTTCATTGTTCAGCTGCTCAAGACGCTGGCGGAGAAGAAGCAGTTGGAACCGCTGACCAAGCAGCAGCTCGACGCCCGCAAAGC
CGCTGCTGCGAATACCAAGAAGCCTACGAACGCGCAGTAA