Transcript Name :
Phyra_g2287
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, BED-type predicted9.767PS50808
HmmSmart predictionP-Valprediction_id
Zinc finger, BED-type predicted0.0045SM00614
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0630.0823
InsideOutsideTMhelix
1-780
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
DNA bindingGO:0003677IEA
*** None ***
*** None ***
Sequence
        2342 bases(100 bases per row)
TGGTGAAGCGCGCACCCGCCAGTGCGGAATTCCTGTCGTCGCCGTCCACGCCTGCGGGCCATGCGAGCGGACCGGCCAGCGTGTCGGCCGTGTGGTCGTA
TTTTGAGAAGGACCAGAGCGGCAACTCCGTCTGCAAGTTTTGCGAGCGCGTGATCAAGGGCCACCACTCGTCCAACCTGCTCTCGCACCTGCGCACGGCC
GGGCGTACGGACCCCACACACCAGCAGGCCAACAACGTGTGCGAGGAGCACCGCGAGACCAAGCGCCACCTCAAGCGCCAAAAGATCGGGTTACAGGTTG
GCCAACAGACGGGCGCCGAGCTCGTCATGTACCCGCCGCCCTCGCAGGCTCTGGCTGCCGCTGTGGCCGCGGCCGGAGGCTCGCCCAGCATGTTCTCCGC
TGCACTCAAAAGAGACCCGACGGCAGCGCTCTATACGTACCCGCCGCCGGTGCTGACGAAGGAGCAGCGAGAGTCGCTGGGCTCGGCATATGGCGTGCAG
CCCGTACAGGTCAATTGCGAACAGTTTACACAGGATTTAGCTCTCATGGCCGTGGTAGACAACCTGCCCCTGAACTTCACGACGAAACCTGGGATGCAGT
ACGTCATGAACCAGTTGCTAGGAGAGAAGAAGCTCCCGCTGCCGAGTGAAGAGGCCGTGGGGAAGGCCGCCTTGCTGCTGCAGGAGAGCGTATTCGTGAC
CACCAAGATGGTGCTGACGAGGGCCAAGAGTGTGGCGGTGTCGCTCGAGGTGTGGCAGCACCCAACCCCCACAGAACCAAAGCCTACGCAGTACTTGGCA
GTGAAGATCCACTTCAGCGTCAACTTCCGGCTGTTTGATATTGCCGTCGGTGTCGCGCCGCTGGATGAGACACCTGGGCTAGAGACGATCAAGAGCATTC
TGGACTCGTATCTCGATCGCCTCGGTATAAAGGACAAGGTGATTGCCTGCGTCAAGGATGAGCTGCCAGCCAAGATTGAGCTGACGGCGGCCGATCTCCC
GTCACTTTTTGTGCCTGTTAACTTTGATGGGCGGCTTGTCTCGCCCGATGCAGCGCAGAGCACTTTCCTGCTTACGTCCGCGGTGCAGCACCTGCGTGTG
TGTTTGACGCAGAATGTATTCGCGAAGGCCTTTCCTGAGGTTGTCAATCAGATCGAGGAGTTTGTGGTGCGGTTAGCCGAAAATGAAGGAGCGATGCATT
CCCTCAGCCGCAAGTGCCCACTTCTCAACGTAGAGCTCTTTCCGGAAGGGCAAGAATCGATGTCTTATTACGAGTTTCTGCGCGACTTTCTCGAGCATTT
GCCCACACTGGAACAAATTGCGAACGCGAACCTTGTGGAGTACTTACCTGCACCGACTGTTGAGTTCATCGGGCTACTAGTGAAGAAATTGAGACCATTT
GCCCGATACTCAGAGGCGTTAGAAGGAGAAAAGAACAAGAAAACTGGTAGCGACAAGGAGGTGAACAAGAGCGGCATTTCCAGTATTTCAACGATTGCTG
CAGCCCTGGTGACGTACGCAGAGAAGCAAGCACAATCGGCTGTTGAGAGCGTGCCATCCCATCTAGGGCCAGTCACGTGGAAGCGCTTCTTCGATACGGT
GGCAAGGAAGCTGCGTGAGCAATTTGCAACGCTCCCAGCAGTGTGCTACGCGGCGACGCTCTTCGATCCGCGCTACAAGAACCGTGAGTATTGCTACTTG
TCTCCCAAGGCCGATTGCGAGATTGGGAAGGGTTTTCTCCGTCGAATGTTTACACCTGACGTAGCGCAGTCGTCCAATGCGACTGGGTCCTCAGGGCTGT
CTGGCGCAGATACCGCCTATGCAGAGCTGGTAAAAGAGGCCGCTAGCCCAACAGGCGGTGACTTGTCTCTCGAGGACGAGGAGGATGATCTGCTTTCGCA
TCTGCCGTCCGAGTCGTCGAAGTCATCATTACAAAGAGATAATGAGATGGTGGCAACCTGGGAAAAAGAGCTGAGCGCTTTTCTGAGTCTTCCTGCTTCG
GAGCGTAACGTGGACCCGTTGACGTGGTGGAAAACGAATCAGCTGCGGTTCCCATTGATCGCACCTTACGCTGAAATGGTGCTGTCGCTGCCGGCAGCGT
CCTCGAGTGGCGAGACTGTTCGGAAAAATATCTACAATGTGCTTCAGCGTACAGAAGGTGTTGCGCGCGAGGCCGCGCTGGCAGATAGCCCGGCTATGGT
AGAGACTTTCCTGTGCTTTCAGAAGAACAAAGAATACGCTTTGGAATGGTTTCGATCGGGTTCCAACAGCATGGTAGATGCTGTCGGTCTGAGTGACCTG
GAAAGCAACGCGGCGAGCTTCAAACATATCGAGAACGTGTGA