Transcript Name :
Phyra_g12757
Orientation:
(-)
Number of Exons:
6
Description :
hypothetical protein PHYSODRAFT_477034
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1160.068556
InsideOutsideTMhelix
1-528
529-551
552-587
588-610
611-649
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        5010 bases(100 bases per row)
TGGTGCTGTCTCCAGAGGATGAGGCCGCGTACAACATGCTGTCCATGAAGATGCAGCGTGACGTCAACTGCCTGGCAGACCCGGATCGAAGTGTGCGCCG
CCGTGCCGCGGACAAACTGTACCGCGCACTGCAGAATGAGGCGTCGCGGGTGTCCGCTGGAGTGCTGCGCGCTCTGTGCGTAACCAACCTGCAGCGCCCG
CTGCTGCAATGCGCCGAAAGCGATGCCGTCGAGAAATGCCGCGAGCGAGCGCTCACATCGCTACTGTTCCTGTGCGAGAACGGGGCGCTGGAGCCGTCGG
ACGCGACTCTGAAGGAGCTGGTGGCTTTGTCCAGCGCGCGTCTCGGCAAGCTGCCGTACCCGGAGCCGACGGAGGAGATCCGCCTGCTCGTTCTGCAGCT
ACTGCACGCATTCCTGAAGCAGTTTGCAGCAGTGACAGTATCGGCGACGTCACTGCGTGACGTTATTTCGGAGCTGGCCAACGCATTGGGCAAGACGGCG
GTGGACCCGTTCCCGGACGCCAAGAAGATGGCAGCAGAGTGCGTCATCTTGATTTCGACGACTTGGAAGAGCGACGTGGCCTTGCAGATTGGCGCTATTG
TGCGACCTATGGTTGTGAATCTTGGCCACCAGCACAGCCGCGTGCGCGTATGCGCATTGCAGGCGTTGGAAGCTGCGGTTCCCTGTGGCTCGGAGGCTTT
ACCGGAGCTCATCAAGGAGGTGCTTCTCCCAGCTGTTGAGAAGGTTGTATTTGACCATGCCCCGTCCGTGAGGAAGCAACTAGTGATCACGCTGGCTGCG
TGGTTAGCCCAGATCCAGCAGATTCAGCAGTATGAAGCGTCCATCTTCCCCATTTTCCTGGCGGGAATCATCGATGAAGCTCCCGAGGTTCGGCAGCTAT
CTCTCGTTAAACTGAATGAACTTTCAGTAATCTGGGAGGCTCGGGATGAAGATGAAAATGTTAAGGCGGACGATGTAGAGCCGATGGAGGTGGATATGGA
CTCAGCGAAGAACACACCACCTCTTTTCTTTGAGACTCGCCCACCACTTGGAGCTCGGAAACTTGCAGTGACTATTCGAGCGCAGGTGTTGTCGCTTCTT
CTCGAGAAAACGGGGGATTGGACTGTGCAAGTGCGTGAACGCTACACACAAGTTCTCAGTGCGTACCTGGTGTTGCTAGAGCAGAACGTGAACCCATTCC
TCGACAAGGTTTTCTCGGCGTTAGGCAAGACGTGCCGTGACGACGAGGAACCCGTCTTCAACAGTGTGAAGGCTTGCTCAGGTGTTGTCGGGTTTTACGC
GGATGCCCAAATGATTTTGGCTTCTTTGCTGCCAATGGTGGCAGGTAGGCTGGCCGGCCAGGATACCGCGCAGCACCGCACGAATGGCTTAGTCCTGCTG
GGTATGAGTATCGAAGGCATGACAACAAAGACGATTGGAGCTCACCTGGAGGTACGCACGGATTGCCATCAGTAAGAACTTTCGTAGACTATAACTAACC
GCTCTTATCATTGTGCTGATCACCGCTTAGCTGATCACCGAGGCATTGTGTGACGCTGGTCTGCGCGAGTCTGAAGTATCAGACCTGCAAGATCAATTGG
CTGGCGTTGTCGCGAGTATTATTAAGACTGCTGCACCGCTGCTCTCGCAAAAAGATGAGATCTGCTTCCGACTGTTTTGGGTGCTGAGTCACCTCCTCGC
TGCGTCACCAGAGTCATCAGTTGCCTATGAGACGGTATACTACCTGCACGACGTATTGCTGGGTCTGAAATGCGCGAAGGTGCTAACGCTGTCGTTGGAA
TGGAATTAGGCAAGCGAAGCTATGTTGGATCTGGCTGTCAAGATTGAGCAGCCTATTGAGGTTAGTCTCATTTTATTCGTTTGGGTGAAGTACTCTCTAA
TTTGCATGGCTTCGGTTGACTTTAGGTACTTTATGCACGCTACATGGGCAAGCTTCTGGATACTATGAGGCTTCCCACTGAAGCAGCAAACAGTTGGCAA
AAAAGCGACCCGAGTTGCGTACTGTTCGACTCGCTTTGTCGACGTGGAGGAGTGGTATAATACGTTCTATGCTCTAGTATCTCTGCTAGAAGCCCATTTT
AACTTGTCGTTTTGGTTTGCTTCGTTTAGGCATGCGGTGTAAACTTGAAGAAAATTGTGCCCGTCTTCTTGGTGCACCTCGACCCAGTTCAAGATGCGGA
TGTCCGGCTCGCTTTCCTTGCTTTATTGGAGACGATGCTAGGGACGGATGCTATCAGCCAGGTACGCTATCACTCGGCGTAGCTTTTGCTCATGGCTCAT
GTCGTGTCTAATGGACTTGTGTTTACTACTTTTCCAGGCCTTTAAGCCATTTAGTGTTGCTTTGCTCCAGAAAACTATCATTCCGAACATCGTGTGGCGT
GGAGGGCGTGTTGCTGCAACTATTAGGTGAGTGATAAATGCTTTGAGTAAGGTTATCTTCCTGTAGTACTGATGCTTGGACTTGTTACTTGCACCCATCA
GAAAAGTAGCTGTTGCTTGTGCATACACGCTGCTTCGCCACGGCATTGCCGACCAGCCGTGCTTGTTTGAGACTGCACCTCAGGTAAATGCTTGTGTATT
GGTAGTACCCTCTCTGATTGTTAGTGCTTGTGCTAATACCTGCGCTGTTGCTATCATCGTAGATGCTGCCTGTGCTTAAATCCTCGATGGATGACAGCGA
TGCCAAGACTCGCCAACTGGTCTGCCTTGCGCTGCAATATCTATTCGTAGCATTGCCTGGGTGCTTGGGGGGTATGAAGCACGTCTATTTCTCAGAAGGG
GGGAGCATATTTCTCACGAACAGCTATTGTGATTGTTGTCTACAGAGGAACCAGTTCATCAACTCTACGCCGAGATTCTGAAGCGCCTCGATGACAGCAA
TGACACTGTGCGAAAAGCGGCGTGTCAGACGTTTACCACCTTTTTGAAAGCTGCGCCGATAGAGCATTTCCAAGGAACAATCATCGATTACACGTTGGAC
TGCCTTTTTGTCCACCTAGACGATTCTGAGCCCGACATCCAGGTAAGCAAGGACGCACAACAACGTAACTTGAATCGCCTTACGATTCTTTTAGCTGTAG
AGGTGTACTAATTCTTCAGTTGGTTGGTTATCGCGCAGGAGGCCGTCTTCAATGTTCTGAAGGAAACGGTAGCGATCGACGCTCCCCGGCTGGCGAAGAA
GGCGCAAGAGAATCGGACTCGTCACCAAAGTCCTCGCTATTGCGATCAGCTTCTTGCGCTAGCGACTGCCCAGTCGGCATGAGCGATGTTATCGCTCAGC
AACTCACTTTGGCATTACAAAAAAGAGTGAGCTCACCGCAACCAATCTCAAGCTCTTTCCAGCTTTTGCTCGTCCAAGTTCTTGAAGTACGCAACCAAGT
CGTCGATCCGCTTCTTGTTCTTCTCCTCATCTTCTAGCTGCTTCTGGAGCTTGAGCGCCTTCCTTTTGCGAAACGAGGTCTTCGCCGTCTTGAAGGCGAA
TATTGGTGGTGATTCTTGGTTCGCAGTATTCTCTGTCTTCTGTCGCTTTAACAGGCCTCCACGACCGGAGCGAGACTCCAAATCGCCCTTCCTCTTGCTG
TTTCGTCCTGGGATCGCTGCATTCACCGCGTTCTCCTGCACAAAAGCAAGCACGTCAACCGTGTTTACTCAGCTATTCCTAGCTGCAAGCTCCACCTTGT
CATCATAAGAGCAGCCTGGACATGGCGTGACGTTAGTATAAGACCCATGTATACGCCGGCTATTCTTGCAGCTGCCCATCAGCCAGCCGAGGTCGGTCGA
AGCTGCGAGCGCAGGCGCATCCGCACTCACTGTCCTCTTCTGGCGAGTCGTCCAGCTCGTAGGTCTTCTTCATCGGCGCCTTGAGGCTCTGGCGGCGCGT
CTGCATCTTGGTGATTGAGCGAGTGCGGAATGCAAGTTGAAGCGTGACCATCACTCCAGGGACAGGATCTTAGGTGGCCAACGATTGGTCCAATTCAGCC
TATTTTTGATTCGCTAGTTGTGTGCTATTCTGGCCAACCGGAGCCTGCCAACAGTTTCTCTGTGCCCAAGCCACTTCTCTTTCCCTCGACGACCAGACAA
GCACCGCCGTTGCCATGAGCGCTATGAAGGTCGCGTCCGACGAGCCCCAGGGCTCCATCACCATTGAGGTGCCGCAGCACGCGCTGCAGAAGATCAGAAA
CCAGCTCGTCAAGGCCGTCGATATCCGCAACGTGCGCGGCATCTCCCAGTTCTTCGGACTCGGTGCGGTTCCCCGCTCTCCTCCATCCTAGTCCCTTTCT
ATCAATGCTAACTGGTATGCTGTGGCTGATCGACCTACCAGGCGAAGAGAAGCCGTTTAATGTGCCTGGCCGCGATGTGCTGGCCTCGCGGTGCCGCAAG
AACGCGCTGTTCTTCAGCGCCAACTACGCCATCTCCGCGGCGCTGGTGGGCGTCGTCACCATGTACGTCGACGCCGTGCATTGCGTCGCCAGCGAGATGA
GAGGACGCGTTGCTGACTGTTGTACTTTTGGTGCAGCCTGCTGAACCCGTTCTTCCTCTTTGTGCTCATCTGCCTCGGAGGCTTTTGGCTTTACATGTCG
AGCGCGACGGCAAATGAGTCGCCCGAGAACCCGACGAAGATTATGGGGCGCACGGTTACACCCGACCAGCGGAAGCTCGGTATGCTCGGTGGTACGTTAG
TGCACTATTCTTCAGTAGCTAGCGTGAAATGTGCTAACGCGTATGCTTTGCGACTGCATTTGCAGTGAGCGCCGCTGTGATTGTCGTGTTTGGAGGATCC
ATCCTGTTCACGATCTGCTCGGCCAGGTAAGTGCTAGCGATTTCTAGGACTGCGGATGTGGTCAGCTTGCTAAATATTGTGCTTTACTATAAATGCAGCG
GAGCTCTGGCTATTTCGCACGCTATTTTGCGCGACTGCCCCTCCATCCGCGAAGAGGACGAGCTGGGTTTCTTGTCCAGCGAGGCGGACCAGATCGCGGA
TACTGTTTAA