Transcript Name :
Phyra_g12737
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_468947
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.040.024272
InsideOutsideTMhelix
1-1096
*** None ***
PositionContextScore
852SSRRPVR|SS0.515
857VRSSSKR|SS0.579
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3443 bases(100 bases per row)
TGTCGGGCGGGCACCTATCCAAGGAGTTCTTCGAGCTGGTCAAGTCGATCGGCGAGAGCAAGTCGAAGCAAGAGGAGGACCGCATCATCATCCATGAGGT
GGCGCAGCTCAAGCGCAAGCTGAACGAGGTGACGGCGTCGTCCAGCACGTCCAGCAGCCTTGTGAACAAGCGCAAGCGCGAGTTCCTCATTCGCCTCATG
TACGTGGAGATGCTGGGCCACGACGCGTCCTTCGGCTACATCAAGGCGGTGGAGATGACTGCCAGCACCAACCTCATGCAGAAGCGCGTGGGCTACCTTA
CGTGCAGCCTGTGTCTGTCGCCCACGCACGAGTTCCGCTTCATGATCATCAACCAGCTGCAGAGAGACCTGCAGAGCTCCAACCACCTTGAGGTCTGCGC
GGCGCTCATGGCCGTTTGCAAGCTCGTGACGGTGGAGATGGTGCCGGCCGTGCAACCCATGATCCTCGACCTGCTGCGCCACGACGCCGAGCTCGTGCGC
AAGAAGGCCGTCATGGCCATCCATCGCTTCCACCAGCTCAACCCGGACTCGGTCAGCGACGTTGGAGACGCGCTGCGTCGCACATTGTGTGACCGCGACC
CCAGTGTCATGGGAACTACGCTCTGCATCTTGCACGACCTGGCGGAGGCCATCCCCACGGACTACAAGGACCTCGTGCCCAGCTTTGTGAGTATTCTCAA
GCAGATCACGGAGCACCGTCTGCCTCGTGAGTTCGACTACCATCGCATCCCGGCCCCCTGGATCCAGATTCGTTTGCTGAAGATCCTGGCGCTGTTGGGC
CAGGCTGACCAGCAGACCAGTGAAGGAATGTACGAGGTGCTGCACGATGTCATGCGTCGTGCTGACACTGGGATCAATGTGGGCTACGCTATCATCTACG
AGTGCGTGCAGACGGTGACTACCATCTACCCGAACAGCACACTGCTGGATGCCGCGGCTGCTAGCATTTCGCGCTTCATCTCGAGCGATAACCACAACCT
GAAGTACTTGGGTGTCACAGGACTTGCTGCCATCGTTAAGGACCACCCTCGATACGCTGCAGCACACCAAATGGCTGTCATTGACTGTTTAGAGGACCCG
GATGAGACGCTAAAGCGCAAGACGCTGGATCTGCTGTACCGCATGACGAACCCCGTGAATGTTGAGTTCATTTCGGACAAGCTCACGCAGTTCCTTCGCG
AAGCTTCGGACGTCTTCCTGCGTACGGAACTTGTGTCCCGTATTACGCAGTGCGCCGAGCGTTATGCGCCCAGCAACGCATGGTACATTCAGACCATGAC
AAATGTGTTCGAACTGGGCGGTGACCTTGTTCGTCCCGAGGTGGCGCACAACTTGCTGCGTCTGATTGCCGAGGGAAGTGGAGAAGATGAAGACCAGGAC
ATGGAGCTTCGTCGTGATGCTGTCGACACTTACCTGGAGCTGTTGGAGCGCCCTGTGCTGCCGGACATTCTGGTGTGCACGATGGCCTGGGTCCTTGGTG
AGTACGGCTACCTGTCGGACGCTATGGAGCTGGAAGAGATCTGCGAGCGGCTTGTGGAGCTTGTTGACCGTCCATTCGACCAGGAAGACACTACTCGTGG
CTACGTGCTTTCAGCCGTGACCAAGATCACGGCGCAGATGGGGCACACTATCGATATGGCCGACGCCATGATGGATAAGTACAAGACCAGTCGTAGCACG
GACCTGCAGCAGCGCTGCTTTGAGTACCTTGCTCTTACCAAGAACTTCTCCCTTATGAATGAGGTCTTCCCGGAAGATGCAAGCTGCGAGGACATTGATG
TTGATCCCAACCTTTCTTTCCTTACCAGTTTTGTCGAAAAGGCAGCGGCTCAAGGAGCACCGCTCTACGACCCTCCCGAGGACTCGGACGACGAGGATGA
AGGTTACGGCCACCGTCGCAATGGCGGTGACTCGAACCGCTTGAATTTTGAGGCCTACAAGAAGCCCGAGATCCCGTACCCGACGAAGCTCCCTCCTGCG
GACCAGCAAGGCGCCTTTGGTGTCAACAAGTGGGGTGGTAATGGTGGACAGGGTGGTATGCCTGGCTTGGGTAGTTCTGGCGGCCCTGATCCTACTGGAG
GGTTTGGCGCTGGAAAGCGCGGCGTGGTCAAGAACGTGTGGGGTCCTACTGGTCTCAATACGCCCGATAATGCTGCACCCGGAGCTCCCGGAGCTCCGGG
TGCCGGCGCTCCTGGAGGTTATCCTTCCGACCCGTATAATCAGGGAGCCGCGCCCGGTCAGGCTGCATACGGCGGCCAACATGCGTATGGCGGCCAGGGT
GGATACGGTGGTCAGCCCGCCTACGGTGCTCAGCCTCCTCAGCAGCCACCGCAGCAGGAGTACGGTGCCCCGAACAGCTACGATAACGGTGAGCCTACGA
GTGAGGACGAATCTAATGGCAACGTTGACGAGCGACAGATCCTGGCTTCCGCGATCTTTGGTGGCATTCCTGGTGCCCCGGCACCGATGCCTGGCGCTCG
TCGCGTGGGATCAAGTACGCGTTCAACCCTCAACTCCAGTCGCCGCCCGGTCCGCTCGTCGTCGAAGCGCTCATCGAACCGCAACGAGCAGCAGCTGCCG
CCTCAACCTCAAGCACCGGTGGAGCAAGCGCCTCCTCCGCAGCAGCCGAAGGTCGAAATGGACCTGCTCGACATTTCGTTTGACGCACCCGCAGCCCCGC
AAAACATAGGCATGTTCCAGCAACCGCCCCCACAGCAGCCGATTATGAACGCAGACCCGTTTGGCATGGGTTCGCCGCTAGCGCCAGCACCGGCCCGCGA
GGCGAGCTCGCCGGCCCCCTCTGCTTCTTTGGATCCGTTCGACATGTCTGGACTCGGCTCAAGCATGAATGGTAAGTTAGGAAAGGTTTCTGATGCATCA
GGATGGTGGATGGTTGCTAAATGGCTTGGTTTGCTTTTGTTTGTATGTGAAGCTGCTGTTGAGCTTGGCAAGAGCCCTGCCAATGGTTTGGATATTCTGG
GTGGCAGTAGCAGCAGCACCGGCGTTTTCCAGTACAATGGACGGCAGCTGGAGCCGTGGCAGATCACCACGCAGGACTTCGGCGGCCGTTGGGGCGCGTG
CCCGTGCGAGCAGAAGACCAAGGTGAACCCGAGCGGCATCCGCACGCTCGAGGATTTCATGGGCCGCATGCACCAGTTCAACGTGCACACCGTCGAAGCC
ATCCCAACCAGTACGTCGCATAACTCTTTTATTCTGCGTTGTGTGGCCGAGCTCTAACATTGTCACTTTGCTTACTCTCCAGCCAACGAAGCGATTGCTG
CCTGCCGTCTCGTGAACTCGGAGCACGTAGGATTGCTCCACGTGAAGATCCGCAGCGGCGGCTTCGTGGACCTGACGGTCCGCACTGCCGACATGGAGTT
CACCAGCCAGCTCCTGGCCGCCACGGCGCAGCGGCTCAAGTAG