Transcript Name :
Phyra_g12759
Orientation:
(+)
Number of Exons:
1
Description :
putative glycosyl transferase family 48 protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.8410.88725
InsideOutsideTMhelix
1-6
7-29
30-459
460-479
480-523
524-546
547-555
556-578
579-584
585-607
608-638
639-661
662-1041
1042-1064
1065-1073
1074-1096
1097-1184
1185-1207
1208-2077
2078-2100
2101-2119
2120-2142
2143-2151
2152-2174
2175-2232
2233-2255
2256-2342
2343-2365
2366-2376
2377-2399
2400-2408
2409-2431
2432-2435
2436-2458
2459-2640
*** None ***
PositionContextScore
87EFNSSKR|SF0.536
2602SLSRTRR|AF0.771
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        7922 bases(100 bases per row)
ATGGGCCGGAGGACCTGCGCGCTGCTGCTGCTGGCGCTCACGGCGCTGCTACTGCCCGCGGGCGGCGAGGCATTCCTGCCCATCACACGCCACAACCTCA
CGGCTCTCCAGAAGCGGTGGATCGACCCGGACACGGACCCCAAGTTCTACAACCTCTCGGTGCCCGCGGGGCCGCAGAACTTCCCAGACTACGGCGGCAA
CGCCAGCGAGATGAACGAGTACACGCTCATCTTCTCGGACGAGTTCAACAGCTCCAAGCGCTCGTTCGAGGCCGGCTTCGACTCCAAGTGGACGGCCCTC
GACATCCGAGATACGACCAACATGGGGCAGCACTACTTCCTTCCCCAGGCCGTGCAGATCGACAAGGGAAACCTCGTCATCACCACCTCCAAGCCCAAGA
AGCGCTACCGCGGCACCAAGTACGTCAGCGGCAGCGTGCAGACGTGGAACAAGTTCTGTTATACCGGCGGCTACATTGAGGTCAAGGCTATCTTGCCTGG
CAAGTGGGGCATCCCCGGCACGTGGCCGGCTATCTGGATCATGGGCAACATTGGTCGTGCTCCGTTCCTGGGCTCCCAGGACGGCACGTGGCCGTGGAGC
TTCGATGTCTGCGCCCCCTTTGTGGAGAAGACCGAGAAGGTCAAGCAGAAGATTAGTGCCTGTGGCAACCTGACCAACAAGCACGACAAGAGTTCGTACC
CGGAGATGTACGGCTTGAACCCGTTCCAGGGTCGTGGTGCCACGGAGATTGATGTGATTGAAGCGCAGATTCGCGCCCGCGATGAGCCAGCGTTTATCTC
GACGTCGCTGCAGATCCGTCCTAGTCTGTCTGAGGACATGCGTCCGGGTTCGGAAACGCTTCCTGCTCCTGGACAATGGTATCAGGGCCTCAAGTTCGGC
GAATTCACGCGTATTAACAGCGACTACTATGGTGAGGTTGGTCTCGACTCAATCTCAGCTTTGACGCAGCTTGAAACCAACGCGTTCAGAGATTTCCACT
TGTACCGCCTGGATTGGTCCCCTGGTCCAGAGGGTTACATCCGTTGGTGGCTCGACAGTGCCTTCTTGTTTGAAATTCCCGGCTCAGCGCTGAGCAAGTG
GGTGGGTGATGTCCCTCCTCGCCAGCTTCCTGTGGAGCCCAGCTACATTATTCTGAGTACTGCTGTCTCTGAAAAGTTCTCCCCGCCGTGCGATGGTCAG
ATTTGTGACTCGATATGGCCCTCGAACTTCACGATTGACTATGTGCGCGTGTACCAGGGCAAACCGAACCGATACACGTCGGTGGGATGCAACCCAGAGG
CGTATCCTACGAATGAATGGATCTACTCGCATCCGGTAGACTATGGTCTTCCGTGGTACGGCTCGCTGCGCGTGGACACCATCCTTCTGCAGCTTTTCGC
AGTGATTAATGCTCTTGTGGGCTTTTTCATGGCTTTCCGAGGCACGTCTCACCCGAAGACGATGTCAGCCTACGCTAGCTCGTTGTGGCTTACTGCGTTG
TTTTATGGAGCGATAAGTGCAAGCGCCCCAGAAGAATTTGCCTGGATCCAGACTGCTGTTGCATGCCTGTGTGGTTTCGTGGTCGGTGGTATTTGCTGTC
TCGTGTACCCGATTTCGCTAGGTGCGATGCTTGGTTTGTATGGTGGCGTAATGATAAGCCAGTTCGTGCCTCTGCTTTCTACGCGGGTGATCACTGCTGT
GTTTGTGGGTGTGGGCATCGCGCTGGGGTGTGCGCCGCAGATCGACACCAAGCACATTGTGATCCTGTCAACGTCTTGGCTGGGCAGTCTGGCGTTTTTG
CTATCGATTTCGCTTTGGGTGAGCGAGGGTGACATTGCCGACAACGCGTGGAACCTCGCTGGCTTTATCCTCAACGGCGACAGTCACGACCATGTTGGTT
TTTGCTCGGAGCACTGCTTAGCGATGTATGCGCTTCTTCTCGTGCTCAGTGCGGTCAGCACAATCTATGGGTATTACTACTTGCGTGGTGTGACATTGCG
CCATAACGCGATTAGTGCGCGCAAAGCTAAATTCCCGCAGGTTTCTGCGAGTTCGGACGCTCGATCGTGGAGACCTGATGAGGAAGTGTCGGGAGCTGAG
AAGAACATGACCAACTTCTTTTCACCGAACAAGCTGCCGCACAACATGCAGCAGTTCAGCACAATTTTCCGCATCGCTGTGAATGTGCAGCGATCTTTTG
GATTCCAACTTGACAACTTCCGCAACCAGACAGAGCACATCGTAGTGTTGCTCACGAACAACACTCGTAAGAATGGGAACCCGTATCGAAAGCTGCACGA
TTTGGTGTTTTCTAACTATAACAAGTGGTGCTCGAAGTTGAGGATTCAACCGCTGCAATGGAGTGAGCAGCGGGCGCCACAGGGAGGCCTTACGAGCGTG
GACGAGATCTCGGTGGACTTGTGCCTGTTTTTCTTCATCTGGGGTGAGACTAGCAACCTGCGCCACTCTCCCGAGTTCTTGTGCTACCTTTTCCATAAGA
TGAAGGAGGAGTTTCCGTCGGTTCGTCACTCCGAACGCGAGGCTGGATACTTCCTGGATACGGTGGTAACACCTGTCTACGGCCTGTTGAAGGCTGAGAT
GATGTCGAAGCACGACCACGAGGACCGCCACAATTACGATGACTTCAATGAGTTCTTCTGGACGAAGGCATGCCTGAAATACGACTACAAGCACGAGGAA
GTTCTCGACATGACGTCGCCGAGCCCTGCCATGATTTACCAGCAGAAGAAAATGCAACGTGAGGGTCTAGGAGGCCTCAGTACCCGAGGTGGGCTGAACG
GTGGTTCCAAGAGCGGCAATTTCTTCCAGAAACGCAAGAGTATTGCTGAGGGATTCACTGAATCGGCGAAGACGTTCGTGGAGAAACGAACATGGTTACT
ACCGCTGCGCGCCTTCAACCGTATCTTCAATTTCCACGTGATTTCATTTCACTTGTTGGCAGTTCTCGCTTTTGCTAACGAGCAAGAGATGAACTTTGAC
GACTTGTGCAAAATCACGTCAAGCACTCTGATCACACCCTTCTTGCTGGACATTCTGCGTGATGGTCTCGACATCTTCGCAGTGTACCATGTGCACCAGA
GAGCGTTTTCGACGGTGCGTAATGTTTTGCGGGTGCTTTTGCATCTGGCGCTTGTGGTGACGTCGTCAATGCTGTACTGGTACGCTTGGGCGTATGGTGG
TCTGTGGTGGCAGACGTACTACGTCGTCACGGTGATTTTCCACGTGCCTGGGCTGATCAACAGCGTCATGCAAGTCATGCCCGGCCTCACAAACTGGACG
CGACGTACTACGTTTGTTCCCATTGCCTTTATCCGTGATATTGTGAGCCCGATGAACCGCCTGTACGTGGGCGACAACGTCTTGGACCCGGAGTCTAAGA
GCGTGGGCTACCAGTTTTTCTGGGCTTCGCAGCTTTTATGGAAGCTGTACTTCAGCTACAAGTTTGAGATTTCCCCGCTTGTGGTGCCGAGCTTCTTGCT
GTATGCCGACCATGTGGAGAATAACGTGAGTATGATTACAACGATGTTTCTCATCTTCCTGAACTGGATGCCATTCTTCTTGGTCTTCTGCGTGGATATC
ACGATTTGGAACTCGATCTGGATGGCTTTCACGGGTACCTTTGTGGGCTTTTCAGCGCACATTGGCGAAATTCGCAACTTTAGCCGTGTGCGTTCTGCGT
TTAGCCGTGCTGTGGATGCGTTCAATGCAAAGGTGATCGCTCGAAACTCGAAGACTGGACTTCAGATTGCTGAGAGCACGGGAATGTCGTACGGAACAAC
CGCTGTTGGCCACGAGGTGCTAGATCGCGTTGCAGGTGGCGCGGACCCGACGTCTCGAATTTTGTCCCAGCGACGTACTTCGGTGCATGATGATGAGACC
CCTCTGCTCTCTTTCTCGCGTCGCAAGCAGACACCAATGGAGCGCCAAGCTGCTCGTCGGCGCAAGTGGTTCTCGTTCTCTATCGCATGGGATACTATTA
TCGACAGCATGCGCGCGGACGATTTGATCTCGAACAGGGAGAAGGCTCTGCTTCACTTTCACCGCCTCGATGGTTACCAACGTGAGATTTACCTGCCACA
GTTCCAACTGGCTGGTTGCTTCGAAAACTTCACTTCCAGCATCCTTGACATTTACTCATCTAATGACGGCAAGGTATCGGAACGTGTGTTGCAAGACAAG
CTTCTGGAGATTCTCAGTGAAAGTCCGATGGTGGAGGAATCCGTCGAAGAGATTTGGGAGCTTGCGAACTGGATGCTTGTCAACGTGCTCGGCCCATGCC
ACAGCAACGATGTGAAGTACATCACGAGTGTTCTCAACTCATGGGCAGCACGCGGTGTATTCCGCGCACTTAACCTTCAGAAGGTGGCTCCTTGCGGTCG
TGCTTTGGCTAGCTTGGTGTTGTTATTGAAGTCCAACGCCCGTGCCTGGAAGAACGGCGCCAAGGTTATCCCTGTGCGCAAGGATCCCTCTGATTATGCG
TCGTACGAATTCCCGCAGCAGTCGAGCTCGTACCGCCCTGCTCCGTCGGGCCTTACAAAATCTGCTAGTACGACGGGGTTGTCGTCCTTGGGCCTTGAGC
CTCCTCGTCGCAGTCGTGGTTCTGGAGTTGCTCGTATTGCGCGTATGCAGCAGCAGACGCACAAACCCGCGGTCAACAATGGCAAGGCCACGCACTCAAT
TCCGAGCGCTCACATCATGCAGATCCGCGAGCGTGTGCGCACGTTCCTGAACTTAGTGAAGGAAATGCTGGCTCATGTTCACGAGCAAGATCCGGTGTAC
ACGGAGAGCAAGGGTATTTCGGACCGATTGACATGGATTCTTACGCAAGAGCGCGGTTTCATGTGGGACGATAACTACACGGGTGAACAGATCACGCTGA
CGTCGTTTGAAAGCCACACGGACGTGGTGCTGTCACACCTGCATGGACTTCTTACCTTGCAGAAAATTGATGCTGAGCCACAGTCTTACGATGCGCGCCG
CCGTCTGCTGTTCTTCGTGAACTCGATGTTTATGGATATGCCGTTGGCGCCGTTGCTCGAGGAAATGAAGTCGTGGAGCGTCATGACCCCGTTCTACGCC
GAGGACGTGCTGTACTCAAGAAAGGATCTTGAAAGTAAGCAGGATGGTTTGGATGTGCATACTCTGCTGTTCTTGCAAACGCTGTACAAGCGAGACTGGG
AGAACTTCCTGGAACGAGTGAAGCCGAAGAAGAACATCTGGAAGGATCCAGAGACTGCTATTGAGCTGCGTATGTGGGCTTCCTTGCGTGGCCAGACGCT
GTCGCGTACGGTTCAGGGTATGATGTACGGTGAAGCAGCCATTCGACTGCTTGCGGAGATTGAGCAGGTGCCGCAGCAAAAATTGGAGGAACTGATCAAC
ACGAAGTTTACGTACGTCGTGGCTTGCCAGATTTATGGCCGCCAGAAGAAGAACAATGACCCGAAGGCGAGTGACATCGAGTTTTTGCTGCACCGCTTTC
CGAACCTCCGTGTTGCTTACATCGATGAGGTGCGCGTGAACTACCAGAAAGAGCAGTCTTACTTCTCGGTACTCATCAAGGGTGGCGAGGAGCTTGGCTC
GGTGCATGAGATCTACCGTGTGCGGCTGCCAGGCAACCCCATCTTGGGTGAAGGTAAGCCTGAGAACCAGAACTCGGCCATTGTGTTTACTCGTGGCGAA
AACTTGCAGACAATTGATATGAACCAAGACGGATACCTCGAGGAAGGGCTCAAGATGAGAAACCTCCTCGAAGAGTTTGACAAGGGCACAGCTGACCGGC
CGTTCACAATCGTGGGCATCCCAGAACACATTTTCACGGGTAGCGTGAGTTCGCTGGCTAACTACATGGCACTGCAGGAGACGTCCTTCGTGACACTGAG
CCAGCGTACACTGGCGCGGCCACTGCGCATGCGTCTGCATTACGGCCACCCTGATGTGTTTAACAAGCTCTTCTTCATCACGCGCGGCGGCATTAGCAAG
GCCAGCAAGGGCATCAACCTCAGTGAAGATATCTTTGCGGGCTACAACAATTGTATGCGAGGGGGTTCTGTGACCTTCCCGGAGTACACGAAGGTCGGTA
AGGGGCGTGATGTCGGTATGCAGCAGATCTACAAATTTGAGGCCAAGCTGGCTCAAGGTGCAGCGGAGCAGTCGCTTTCGCGTGATGTGTATCGCATTAG
TCAGCGACTGGACTTCTTCAAGCTGCTGTCGTTCTACTACAACCACGTGGGCTTCTACCTGTCGACGTCAATCATCATCTGGACCGTTTACATCCTGTTG
TATTGCAACCTGCTACGCGCTTTGCTTTCACTTGAGGGTGTTGGCGGTCGCGAGCCTGTACTGCTGAGCAATTTGCAGCTGATGCTTGGCTCTGTGGCGT
TCTTCACGACTGCACCGCTGCTGGCAACGATTTCTGTCGAGCGCGGCTTTAAGGCTGCACTGAACGAGATTGTGGTCCTCTTCGTCACGGGTGGCCCGCT
GTACTTCCTGTTCCACATCGGCACGAAGTGGTTCTACTTCGGACAGACCATTCTTGCCGGTGGTGCTAAGTACCGTGCGACGGGTCGTGGTTTCGTGACG
AAGCACTCGTCTTTCGACGAGCTCTACCGTTTCTACGCCAGCAGCCACCTGTATGCTGCAGTGGAGATTGCTATTGGACTCACCCTTTACTACAAGTTCA
CAGTTGGCTTCCAGTACTTATCGACGACGTGGTCGCTGTGGCTTGTGTTTGTATCTTGGTACTGGTCTCCGTTCTGGTTCAATCCGTTGGCGTTCGAGTG
GTCTGACGTGATGGAAGATTTCCGTTTGTGGTTCAAGTGGATGCGCGGTGACGGTGGCAATCCAGACCAGTCATGGGAGGCGTGGTTCAAGGAAGAGAAC
GCGTACTTCTCAACGCTCCGTCCGTGGTCCAAGGCGTGCATTACGGTCAAGGGTGGATTGTTCGCATTGATCGCGCTCTCTATTTCATCGACGAGTGATG
AATATCACTCGATCCTGACTGAGTCGACGTGGCTTCCGTTGGTAATCTGCTGCTCCATGGCTGCAGTGTACCTTAGTGCCGAGGCAGTCTTCTTTACCTC
ATCGCGTTCCAACGGTGAGAATGGACTTGTTCGATTCCTGAAGCTCATATTGGTGCTTGTGCTGGGCGCTGGCCTCATCCTCGCCTTCATTTATGTGGAT
GGTATGTGGCAGTGTCTGCTGAGCATGGGATACCTCGCTGCGGCTGTAGGCTGCTGGGCGCTTGTGCTCCTCGGTAGCAACTCGCGTTTGGTTGGCACGC
TTTACTTTGTGCACGATGCTGTGCTCGGTTTGGTGTCGTTGAGTCTCATCCTGTTGCTCGCGGCGCTTTATGTCCCCGGAAAGATCCAAACATGGCTGCT
GTACAACAATGCGCTAAGCCGCGGCGTGGTCATCGAGGACATCCTCCGAGCCAACTCAAGCAATGACGACCGCGATGACGACCTGTCGGTGCAACAGATG
CGCTCGATCATCATGGAGCAGCAACGATTCATCAACGTACTGACTGCCAGCGGCAGTGATGCCGACATACGTGCTGCTGGCTCTGGCAAGAAGGAAGACC
TCATGCACGCTATGAGCGACAACACGCTTAACGCGGTGTTGCGGAACATGTCGGAGACGGAACTGAGCGCACTGCAGGACTCATCTAGCCGCCTGCAGGC
CATTATGTCGGAGGAAGAACGCAAGGTGGCGCATCGCAAGAAGCAGCAGGAAGAGCAGAGACTCGTCGAGGCGGGCATGAACCCATCACTGTCGCGCACG
CGCCGAGCCTTCTCCACGAGCGATTTTTCGGCCATTCTGCCGAACGCGAACCCCTTCAACCCCCCGAACCAGAACGGCCCTAGCAATGGTGCTGCCACCA
ATAACGGCCACACTGCCGTGTA