Transcript Name :
Phyra_g12758
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_536873
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Elongation factor, GTP-binding domain0.0000000000000046PR00315
Elongation factor, GTP-binding domain0.0000000000000046PR00315
Elongation factor, GTP-binding domain0.0000000000000046PR00315
Elongation factor, GTP-binding domain0.0000000000000046PR00315
Elongation factor, GTP-binding domain0.0000000000000046PR00315
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.2020.38315
InsideOutsideTMhelix
1-602
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
GTPase activityGO:0003924IEA
*** None ***
*** None ***
Sequence
        2331 bases(100 bases per row)
TGTGGCTCCGTCGGTCCTGCCTGCCTGCCCTGGCGCGCGCGCGCTCGGGCCAGCGCTCGATACTGCAGCGCAGCGCGCCCACGCTGGCGTGCGCCTTCTC
CACCGACTATTCGGCCGTCACGGCTGAGAACATCCGCAACGTGGCCATCGTGGCGCACGTTGACCACGGCAAGACCACGCTGGTGGACCAGTTGCTCAAG
CACGGCGGCAACACACTCTCCGAGGAGCGTGTCATGGACTCCATTGACCTGGAGCGCGAGCGCGGCATCACCATCATGTCCAAGTGCACGCGCGTCGAGT
ACAACGGCCACGTGCTCAACATCGTGGACACGCCCGGTCACGCCGACTTTGGCGGCGAAGTGGAGCGCATCCTGAGTATGGTGGACGGCGTGGTGCTGGT
CGTGGATGCCACGGAGGGCCCCATGTCGCAGACCAAGTTTGTCCTGACCAAGGCGCTGCACCGCGGACTGAAGCCACTCGTCGTTGTCAACAAGGTGGAC
CGCGACACCAGCCGTCTGGATGGATCTGTGGAGAACGAGCTCTTCGACATGTTTGTGGCGCTTGACGCCGACGACGACCAGCTGGAGTTTCCTGTGCTGT
ATGCGTCAGCGAAACAGGGCTGGGCCGTGCACGACCTGGACAACGGTGAGGCGCGTGACAGCATGCTGCCGTTGCTGGACGAGATCACTCGCTACGTGCC
TGCTCCAGAAGCCACCGCCGACAAACCGTTTGCGATGGCCGTCACAATGATCGGACACGACCCGTACGTCGGCCGTCTGGCGACAGGCCGCGTACACGCC
GGAACTGTCAAGGTGGGCTTGGCTCGTTCTAGATGATGCTCTTGCACTTCGTACTGACTTTTGAATGTGCCGCGCTTTTTCACTGTGCCATTGACTAGAT
TGGCGACTTGATTCAAGTGATGAACCGCGAGAGCAAGAAGCTTGAGACTGGCAGAGTGACTAAGATGTTCGTGACCCGTGGTGTTTCGAAGTCGGAGATC
ACGTCGGCTACCGCTGGTATGTTTGAGAGCATCACTCTTTTATGCTTGAAGGCGTTTGCATGCTAATACTTCATGTTTTGTGCTTAACTCGTTGTAACAG
GTGACATTATCACCATTGCTGGTGTCAACGCGTATGTGTCCGACACCATCGCTGACGTGGCCGTGACGGAGCCGATTCCCTCTCCGCAGCTGGACCCGCC
CACGATTTCCATGACGTTTGGTGTGAACGATGCGCCGACCGCAGGCAAGGATGGAAAGTTCCTCACATCTTCTCATATCAAGCAGCGCCTTGAGCGCGAA
TGCGAGGTCAGTGGGATCTTGCTTTTCTTACTTTTTTGTTGAGCTGAGTGATTCACTGATGAATGATTGTGTATTGATGTCTTCAGAACAACGTTGCTAT
CTCCATTTCTCAAAGTAAATCGTCGGAGGCCTTCGATGTGCACGGCCGTGGTGAGCTTCAGCTTGCTATTCTGATTGAAGAAATGCGTCGTGAGGGCTTT
GAGATGTCTGTCTCAGCCCCCCAGGTGCTCTTCCAGACGGACCCGGAGACCAACCAGAAGTTGGAGCCTATCGAAGAAGTGACGATCGATGTCGACTCCG
ATTTCTCTGGCACGGTTATTGACAAGCTGGCGACCCGTGGTGGTGAGATCATCGAGTTCAAGGAGATGCACGACAAAGTGCGCCTCCAGTTCAAGATTCC
CAGTCGCTGTCTCATGGGCTACCGCAGTGAGGTGCGTAAATGCGTTGAATCCGAGCACTTTTCTCGAATAAGGACTTACTCTGGATCATGTTTCCTATGT
GTAGATCAAGACTGACACTCGCGGAAGTGGAATTCTGAACTCGATTTTCCACGGCTACTCACCGTTCCAAGGCTCGGCTACTCCTCCGTCGAAGGGCAAG
CTTATCTCCTCGTCTGGAGGCATGTGCACGGGAAGATGATAGCTTAAATGTACGATCGTTCGTGCCCCCAATCCTATTTACTCAATATGGCTTGCTGGAA
ACAGGCTTACGCGTTGAACACGCTTGAAGACCGCGGAGAGATGTTCGTGAAGCCTGGTGACGAGGTGTATGAGGGTATGATCGTGGGTGAGCACAGCCGC
CCTACGGACATTGAGATCAACCCCACCAAGGAAAAGAAGCTCACCAACATGCGTGCTGCCGGCACGGACGAGAACGTCAAGCTGTCTCCGATCCGCGTGA
TGTCCCTGGAAGATGTTGTGACCTACATTGGCGAGGACGAGATGATCGATGTGTCCCCGACCAAGATCCGCATGCGAAAGCGCGAGCTCACCGCCAACGG
CCGCAAACGCGTGCAGGGCAAGAAGAAGTGA