Transcript Name :
Phyra_g7383
Orientation:
(-)
Number of Exons:
1
Description :
EF-1 guanine nucleotide exchange domain-containing protein, putative
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Translation elongation factor EF1B, beta/delta subunit, guanine nucleotide exchange1.5e-31SM00888
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.090.06925
InsideOutsideTMhelix
1-190
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
translation elongation factor activityGO:0003746IEA
eukaryotic translation elongation factor 1 complexGO:0005853IEA
translational elongationGO:0006414IEA
*** None ***
*** None ***
Sequence
        572 bases(100 bases per row)
TGCCGACCGACATGAACAAGTTCCAGCTGGTGCAGACCGCCAAGTTCTCGGTGCTGCACCCCATCAAGGGCGCCAAGCCCATGAAGGCTATCGCCGCCGC
TAAGAAGGCTGCTCCCGTTAAGAAGGCGGCTCCGGCCCCTAAGAAGGCCGCCCCCGCCCCGAAGGTCGAGGAGGAGGACGATGACGACGACGACGACCTG
TTCGGCGACGACGATGAGGAGGACGACGAGGCTGCCAAGGCGCTGGCCGCCAAGCGCGCTGAGGCCGCCAAGGCTGCCAAGAAGGAGAAGAAGAAGCCCG
TGGAGCGCTCGCAGGTGGTCATCGAGGTGAAGCCTTGGGAGGCCGAGACGGACCTCGAGGAGCTGGCCGTCAAGATCAAGGCGCTGCCCGTGGAGGGTCT
GACGTGGGGCGAGGGCCACAAGCTGGTGCCCGTGGCCTTTGGCATCAAGAAGCTGCTGGTGCAGTGCATCATCATCGACGACCTCGTGCTTCTGGACGAC
ATCACGGAGGCCATCGAGGGCTTCGAGGACTACGTGCAGTCGGTGGACGTCGCCTCCATGAACAAGATGTAA