Transcript Name :
Phyra_g7385
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_472002
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1290.106248
InsideOutsideTMhelix
1-85
86-108
109-120
121-138
139-167
168-190
191-196
197-219
220-228
229-251
252-271
272-294
295-341
342-364
365-375
376-398
399-401
402-424
425-430
431-453
454-462
463-485
486-492
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1478 bases(100 bases per row)
TGAGCACCAAATGGCTTCACGACATCGAGATCAGGACGTCCTGCGTCGAATTCGACTCGCTCGCGACGCCTGAGACGCCGAAGGATGGTTTCAAGTCGCC
CGTGGTCGACGAAGAGGAGGGGGTGGCTCTGCAAGGCGCTTCATTCGGGGCGTTGCTCGTCATCTCGATGCCTCGCATGGCCATTCGAATGGCTTGGGCG
GCGCAGTGGGCGGCATTAGGACCGTATTTACAGACTATGCTCCCGCGCTACGCCGTTCAGCTAACGCAGCTCAGCGGGCCTCTGTGCGGCGTCTTGATGG
CGCCGATTGTCGGCGTGTACTCGGACCAGAACACGTCGAGGTTTGGTCGTCGTCGTCCCTATCTCGTGGTGGCTGCAGTCGGGAGTATTATCTGCTGGAC
CCTCATGGGGTACACACGCGAGCTTGGAGATGCCTTAGGCGACGTGGGGTCTGGAAAGCACGGGGAAGTCACGGACCGCAAATGGACAGCACTGCTCTCC
ATCTTCTTCTACCTCTGGATGGACATCACTGTCAATGTGGCGCAGACTCCTGCGCTGTTACTCATCTCGGATTTCGCTGGTAAACGCCAGACCATCGGCG
CTGCGCTGGGGCAAGGATGGTCGACGCTTGGGGCAATTGCTGTGGCTGTATACACAGAGTCCTTCGGCGCCGCGTACAACTCGATGCACTGGTTCCTGGG
GATGTTGTCTGTCTTTATGGCTGTCTGTATCGGAGCAGCATGTTACGCGGCGAAAGAGATTCCGCTGGAGAAAAGGATGGAGAAGCGGACTTGCTGCCAG
AACTTGACGTACGCGTTCGGCTCCATCTACTCGGCTGTGTACACGCTTCCTGCGATGCTGGCAGTGTACTTCGCAGTGATTTTCCTGAATCAGTACGGCT
ATGCAGCATACAATGGCAACAAAGGAATGTTCTTCGGTCTCGAGGTTTACGATGGAGACGCCACAAACTCTGCAACTTGTGGCGATGAGTGCTCGGACGC
TCAGCTGGATTATAATCGCGGCGTGAGACTTGCTGGGGGCCTTGCGGACATGCTGTTTTGCATCGTTGGGTATTTGTACTCGTGGGTGCTTCCTGTGTTA
GTGCGCCGGTATGGGGCTCAACATGTAGCCACGTTCGCAACAATTCCACAGGTGCTGCTTATGATCATGGCCTTCTGCGACGTGGTGGCCGTGGACTTGA
TCGTCGTGGCTCTCTCATCGATCACAATCGCTACGTTCTTCGCACTGGTTGTGCCACTCATTGTGCACGTGTTCGGCCACACCGCCGACATCGGCGTGTA
CGTAGGCGTCATGAACTCCGCCAACTCTTCTGGTCAGTTGCTCAACTTCATCGTCGGTTCTGCGCTGGTGGATACATCAATGGGCTACAGATTACCTGTC
TTCGTAGGCGGCGCTGTCAGCTTGCTAGCGTTCATCGTCTGCGTGTTCTTCTTCAGGGTCAAGATGCACTCCATGTAA