Transcript Name :
Phyra_g8413
Orientation:
(+)
Number of Exons:
14
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.3770.45225
InsideOutsideTMhelix
1-2313
*** None ***
PositionContextScore
2023KHSQKAR|SA0.541
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        9957 bases(100 bases per row)
ATGGTGGTGTCACGGCGGCGCTGGTGGTCTCGGGTGGCGGTGGCGTGTCCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCG
TGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAG
CGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGC
GGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCG
CGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAA
TGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGCGGCGCAAATGGAGGCGTGCATGGAGGTGTCGACGGA
GGAATTGATGGGGCCGTTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTG
TCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCGAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCC
ACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGG
CGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGC
GCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGCGGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCT
GGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCG
TCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTC
GGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCGAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGT
GGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCG
GTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGTGTGGCGGTG
GCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGT
GTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGTGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCC
GGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCA
GCGTGAGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGTGGCGGTGGCGTGTCCGGCAGCGTG
AGCGGTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCG
GTGGCGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGG
CGCAAATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGCAGCGTGAGCGGTGGCGCAA
ATGGAGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGG
AGGCGTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGC
GTGAGCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGTGGCGCAAATGGAGGCGTGA
GCGGCGGCGCGAATGGTGGTGTCCACGGCGGCGCTGGCGTCTCGGGTGGCGGTGGCGTGTCCGGCAGCGTGAGCGGCGGCGCAAATGGAGGCGTGCATGG
AGGTGTCGACGGAGGAATTGATGGGGCCGTTGATGGCGTAGTCTCAGGAAAAGGCAATGCAGGTGGTGGGCTTGACTTCTCTGCCCTTGTCGATGGGCGG
CACAGAAGGGTCGTCGCCTTCGAGGATTGTAAGGGCTTGTTGTGCGTAGTGAGTCGGATGTACAAATCAATACAACTTTGGATGTTTTGTATCGTGTTCA
TGTGCATTCCTCATTTACCTGCCTGCGAGCAAGTATCCTGTCAATTCTTGCGGGCAGGTCTCCCCGGTGGACTAGAGTCTGTGAGCGTTCTACAAGCAAC
AATCCAATGAAGACCAAGAAAAAGTGGCAAGGTGGAGCGACTGGAACGTGTACGACCACGATATGGTACTCACAGCGGTCGCTTCACTAGATAGACACTT
ATGTTATGAGTGGGTTGCATGACGAATTTGACGAGACGTGTCCGTGGGTGAAGGCAAACTTAAGTGAGATCAGCACAGTGAGCTTAGATCACGATTCGAT
CCCTGGAGGGTTGTTATCGCTTAGTACATTTTGGCGGGCAGCTCCTAACAGACTTGGAAACGCTGTTGAGCTTGCGGTAGGCTACTGACGGGTTGTTATT
GCTATTGATGCCGTAGTATCGTTTGAACTACGAAGAACCGCTGCTATCCGAAGCACACTACGACAAGTTGGTGCACTCGCTCGATCAATTGCTCAATATC
CACGCGGGTTGTGATCTTTCGAATCCCCCCCCCCCAATTGCATTGTGAATAATACCAAGGTAAGTACTGTAGGCTTCGCGATTGCTTTGAGCTCAAAACG
GCCGCGTGCAATTGACAAAGCTCATTGATCGCGTGCGTGGCAAGCCTGTTTCTTGACTTGCCTATCAGATGTCGGTGATCTATGACGGCCACTTTAAGCA
TTATTTTTGATCGACCCCATTACTACCCGATAAGAATTCGAGTTGTGGTGTGCCGAATGGGCAGCATAGAGTTTGCCATGTGCACTGGTATAGACTTCTA
CGACTGCGGACATGAATATCCATATGCTAGTCCTCACTAAGATGTCGATTGCTATGATCACGCTTCGAAGCCCGACCAACGCGATTCTTCAGCACAGCGT
TGTCACTGAAGTGCCCCCAGAGGCAGTTGACCAGAAGGTTTCTCTTGATATCAGCTACAGCTGGAGGGGGCCTCGAAAGGCTCCGTATCCGCTCCAGCGA
TGCGATGTGCAAAGCTCATTCACCAACTTTCACTCGATCACTCGAGTCCCCGTCTGTCCCCGTCCAGTTTTCAGTGTACCTGCCGTCCTCTTCCTTTCGT
GGAAGCCCAAGTCTTCGGTGAATACCCTCTTCAACAACAAAAATGCTTTCCTGCAAGATGTTCCTTCAACTGTTCGCGGTGGCCGTCGCTCTCTCCGACT
TCACTGCTGATGCCGGACGTGCTCATGCTACCGACTGCGAAATGGCATACGATGCCGTCACTCCAGCCCCAACTACTTCGGTAGCTCCGTGCCCCAAGAG
CAAGTCTTCATTCATCCCCACGCCGGAGGCGCAAGACTTTACACCGACCGACTACGATGGCGAGACTGATACCATGCAAGGCAGCTCTGTCGACACTGAA
GTCTACCCCACCAGCGACTACAACCCCGCCGCTGGAAGCAGCAAGGACGTCGAGGCTACAACCGAGGCTCCGAATGGCGGTAGTACTAGTGTTGACGGCT
CGGGAGGTGTCATTTCCGACGTGGTGACTCCTTCCTCTACTGTTCCGAGCACTGTGGTGACACCGGCCCCTACTGTACCGGGCTCTAAGACCGAGTCGAA
GTCACCAGATCAGACACCAACCGACGTCAACGGCGACACAGCTACGAAGCAAAACATCCCAAGCAGCGACGCCGCCAGTCAAAACGACGATAAAAATGGA
GAAGCAGGCGGTTATGGCAACAAAATAAGCGGAAGCTTGAACGGCGGTGTTAATGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAG
GTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGG
CGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAACGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGC
GGAAGCTTGAACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGA
ACGGCGGTGTCAACGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGT
CAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAGCGGCCAG
GGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAGCGGCCAGGGCGAGCTGA
CCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCT
GAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGC
GTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAG
GTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAACGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGG
CGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGC
GGAAGCTTGAACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGA
ACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGT
CAACGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAACGGCCAG
GGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAACGGCCAGGGCGAGCTGA
CCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTTAATGGCCAGGGCGAGCTGACCGGCAGCCT
GAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGC
GTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAG
GTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGG
CGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAACGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGC
GGAAGCTTGAACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGA
ACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGT
CAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAACGGCCAG
GGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAACGGCCAGGGCGAGCTAA
ATGTCGAGGGCAGCGCCTACCATGACGATGCTATTGATGGCGACACTGAAGGCAGTGCCTACGTGGAGGTTGACGATGTGAATGAAGGTAGCGCGTACGA
TGAGGATGATGGGGAGACTGATGGCATCACGTACGAGCAGGGTGAGGAGGGGAACGATGACAGCGAGGGTGAGGAAGACAGTGAAAGCAGTGCGTACGAG
CAGATTAGTGAGCCCGAGCGCAGCGCGTACGGCGATGCCGCTCTTCAGTATGATGGGGAGATCAACGACAACGTACCGGTAGATGGTGACGACACTCTGC
AGATCGGCGGTGATGTCGATACCGGTCTCAGCATCGGCGGCGACAACGGTCTTTCTCTCGGCGTCAACCTTGGTGGCGGCCTCAATGTCGATGCCGGACT
GTCTGCTGGCGTCGATGTCGGCCTCGGTGCCTTCCACGCTGGTCTCGGCGCCAACGCTGGCCTGAACATCGGTGGCGACACCGAGGTCTCTGCCGGCGCC
GACTCCTACCGCCGCCGTCTGCGCAGCAACTAGAACATTCATTTCTTCATGAAGTAGTTGCGTTTACGTGTTCAATATACACTTTTCATTTGTCCAACAC
CGTCTGTTGTATATATGTTGTATATATGAGGTGTAGCACACATTTTGTATTTGAACCAAAATGGAGGAGTTCGACCGCGAGACGCCGCTGTTCGACCGGC
GTTTCCACGTGCTGGTGCAGTACCCAGACCGGGACGAGAAGCTGTTGCCGCTCACTATCCGCCTGCTCACAGGCGTGCGCGTGCGTGTCTTCATCCGCTG
CCCCCGCTTCCCTTCTTAGACACAATGCTAATTCTTATTTGGTCATTTGTGTATCAGCAAAATAATGCCAAGAACCAGAAGGAGCGTGTGATGCGCGTGG
AGATGACAGATGACGACGGTGTGGATCCGTACTTCCTGTACCTCTGGAGCGTCTCGGAGGAGGAGTTCCACGAGCTCAAGACGCAGCAGCGGCTGCTCGT
GGACTTTGCCACGTTCCCCAGCAACCTCATTGAGCTGCTGCACTGCTGTCTCAAGGACAGCAAGAAAATTGCTGAAGAAGAAGAAGAAAAAGAGGACAAA
GCCAGCGATTTTGGGGAGGAGGAGGCTGCCGTGACGAAGAAAAGCAATAGTGAGACGAAGCACAGTCAGAAGGCGAGGTCGGCGGGACCAATTCCGTTGA
GGTAGGGTGCTGAAGCAATTTGTGAGAGTTCTGTGAGGATGGCTGATGCTTTTTGTGTGCGGTTTACAGCTATTTGGCGGTGCTGAACACGTCGGATAGC
AATGGGCAGTCGGTGTTTAGCATCGTGGAGACGAACCCGTTCAAGCAGTTGACGCATTTGTCGTTGAGGTTTTTCCCGGGTGATGATGCGGCTATTAAAG
CGTATCTTGCAGCGCGGTTGGCGCAGGTTGGAATGAGTAGAAGGTTGTTGTCGACTTCGCTGAAGCAGACGAGCGAGGAGCTACAGGGGACGCGGAAGAG
TGAGACGAAGTTGCAGCAGCAGTTGTCGGCGTTAGGATACGATGCGGAGTCAACGCTTTCTCAGGAGAAGATGAAGTTTGCGGATGAATTGGATCGGCAA
CGCAGGACTGCTGCGACTGCAATGAAAGCGAGGGAGGATGAACTCAATGCTAAAATTGACGCGCTAGTGGAGAGATACGAGAAAGAGGTAAGCCGCTTTT
GCTTCAGGTTGTTCGCAGAGTTGTGTTGTAGCTGTAGACTAATACTTTGTGCCGAGTAGATTCGAACTTTGAAGGCGGCAGCAGAAGCGAGTGAGGCGCA
GGTGCAGGATCTGAGCAAGCTGAAGTACCAGCACGAAATGCAGATCGACCACCTTCAAGCCCAATCACAGGATCTCAGCCAAGGCAGAAGTACGCTCACA
GAGGAAGTGGACGAGCTGCGCACTCAAAACAAACAGTTGGACCAGAAGGTATTCCAACAGGAAAAGCAGATTAACGCATTGCAGGTGCGTGCGGACGCGC
TGCAGCAACAACTTGCGGATAAGGAGGACGTGATCAAGAAAAGCACAGACCTTCTCCAGTCGGCAAAACTCCATAACGAGGAGGTCGATGAGTCATTGAA
AATGTACCGTGACAACCACGCAAGGCTACAGCAAAAACTGGAGCTGAGCATTTCGGAGATCAATAAGGTGAGTGGGCTATGATTCTTACCAGGAGCAAGC
AGCTTCAGCTCAACCAGCCGTGCCGTGAATTGTGCAGGGAAACGAGATTATCGAGCGCATCCAAAACGAAAATCGCACACTGAAGTCGAAAATGCGGATG
AAGGCCAAGATTATCAAGCAGCAAGAGCAGGTATGATGCCCTCATATTGATGCTGTCTCAGGCAGAACCCAGACTCTAACGAAACGGATCTATCCATCAG
TTTGTGGAGGAAAAACAGCTTCAGCGCGAGGAAGCGTTGCTGGAGCTGAAATCGACGAAGGAAGACATTCGCAAGCGGGACGAACACGTCGCACAATTGA
AGGCAGGGACAACCGCATTTGCTCACGTGCATTGTGGCTCCACTCACGTGCTTTTGACTTATTCTGCAACAGGACACGATCAAGGAACTGAGCCAGAAAT
TGGAGGACAGCAACAAATTACTGGCATCCAACCAGCAAGGTATAGTTGTAGCGTGCAGCTCTGTTTCCTTTGGGTTTGTTCTAACCTGAACCTGATGCGC
TGTGAACAGTGATCACATGGCTGAACAAAGAGATCAATGAAGCACAGCTCGGCCACCAGCGGAGGTCGACTGCACACCCTTCCGTGCTCGCGTTCCGTCC
GACGGATAAGGTGATAGCCACAAAAGTCATGACGAACCAACCTCGTCACAGCAACTA