Transcript Name :
Phymu_g11197
Orientation:
(+)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, FYVE-related9.308PS50178
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, FYVE-relatedIPR017455
*** None ***
InsideOutsideTMhelix
1-573
NN-scoreoddsWeighted Score
0.6362.1830.004
*** None ***
TypeScore
nuclear652
GO
*** None ***
*** None ***
*** None ***
Sequence
        1722 bases(100 bases per row)
ATGCACCTTCGGTTCCCTTTGCCGGCCGGCTACTTCGCCAAGTTCGACTTACTACCGAACGAGGCGCAGAACTACCGGTCGTTGGCCAGCGACATCGTCC
GCGAGACGAAACGGGATCTGGATCACTACGTCAAAGACGGACGCAACCTCATCGACGCGCACACGTGGAAACTCGCCAAGTCCAAGGAGCGACTGCACTG
CTACCGGAAGCGCAGCACGCAGAACTCGGCGCACCAATTGGGACTGTACGGGACCGCCGACTCGTCCGACTCGTTCGGCCAATCGACCCGTTCGAGGCCG
TCAATGAGCGTCACGAGCTCCCGTAGTCGATCGGGACACGACGATATGGGCAACTTGTCGGTGTCCACGCGGTCGtcggacgacggcgagcCCAGTCGCA
AGAGCATTCAACCGACAGTGATCGGCTACGGCATTATGGACGGATCAGTGGACGATTTGGTGTACGGGCTGTACCAGTCGTCGACCGACGAAATGAAGAC
GCTGTCAGCGTTCCTAGGGGACGATTCGCTCATCGACTGCGCTGTACTCAAGACGATTCGACAGACGCGGTCGTCGTACCTGGGACTCAAGTGGAATCTG
TCCCGCACCGTCGGCGGCAaccgcgactgctgcttcatggAGTACGTGGGGGTATCGGAGGACGCGAACGGCCAGCGCTTCGGCTATCACGTGCTGGAGT
CCGTCGTGGTCCGCAACTGTCCGCAGTTCGACGACAACTCGATCGTCCGTACCAACATGTCGTTCTGCTTTATCTTCCGACCGGGGAAGCTGGCGGACCA
GGTGGAAGTGTTCATGGAAGGCGCGTTCGATTCGTCCGCGGATGTACTCACTGCTGGCGGTGTGGGAGACTACAGAAGCTCCATGGACATGCTGTTTAAC
CTTCCTACAGCTCTCGTAGGCGCTGAAGCCAAGAAAATCTCAGCTATGGTCAACAAACAGTCCGGGGCGCTGCGGGGCGCGAGCGGCAAGAACCAGAGCG
GGAATCACTGCTCCATCTGCCGTGCCAAGTCCGGCTTGTTGTCGTCCCATACGAATTGCCAGACGTGCGGCGCCGTCATTTGCAGTAAATGCCGTATCCG
GAAAGTGACGTTCTCGCGTCGAGGGAAGATCAAGGTCTCGTGCTGTAAGATGTGCATGGTCATGGTCAAGGACCAGTCGCCGTTCGCAGgggaacagctc
gagcagcagcccgtgaagaccaagaagaagatctcAAGACACGACAGTCGCAGTaggaacaacagcagcaacgctaGGATGGACACGATCAACGCGTCCG
TGTCGACGATGTCCCTCACGGACTCGgagttctcgtcctcgtaccAGTCGTGGCAGTCGAGTTCCGTGTCTTCGCTTCAGTCCGACCTCGACGACAGTTT
CTACAACTCTAATGGTCCGGGGAACGCGATGGTTCCACTTGAGCGGAAGATGCCGGCTCTGATGGAGGGTGGACCGCCTGCTACGACGTaccagagcgag
cagcaacggcagtacgagcagcaacagttcCAACAGCACCAGTTCCTCGTGCGGCAGCAAATGAAGCAGAACGTGGACCCGAATATCCTCCCGATGCCGA
GCCACCGCCAGCCAACGACGCGCGAAGGGCTGTACAAtcagatgctggagctgcagatgcaggccGAGCGGGCGTACAACTTGACCAACCAGAACGCCAA
CATGATGAACTCGGGCCGATAG