Transcript Name :
Phymu_g9668
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_256277
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Kinesin, motor domain1.1PR00380
Kinesin, motor domain1.1PR00380
Kinesin, motor domain1.1PR00380
Kinesin, motor domain1.1PR00380
Profile scan predictionP-Valprediction_id
Kinesin, motor domain55.63PS50067
HmmSmart predictionP-Valprediction_id
Kinesin, motor domain4SM00129
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-793
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
microtubule bindingGO:0008017IEA
microtubule motor activityGO:0003777IEA
microtubule-based movementGO:0007018IEA
*** None ***
*** None ***
Sequence
        2455 bases(100 bases per row)
ATGGCcagcaagagcgagagcgTCCGCGTGTGTGTCCGCATTCGTCCACTCAGTACTAAGGAAGTTCAAGACGGACGGACGTACATCGTGCACGCCAACC
CCGTCCAAGGCGAGATCTCCCTCTCCAACCCGGAAGCCGACGCCCGAGAGCCGCCCAAGAAGTTCACGTTCGACGCGGCCATCCCGCCCGAGAGCTCGCA
GCAAGATGTGTACGCGCAGGCAGCTACCGACATCGTCGAGTCGGTCGTGAACGGCTTTAACGGCACGATCTTCGCGTACGGTCAAACGGGTGCCGGTAAG
TCGCACACGATGGAGGGCTATTCGGAACCGCCCGAGGCTAAAGGGATCATCCCGAACTCCTTCTCGCATATCTTCGACCGTATCGCTGCGGAATCTGATA
ACAAACAGTTCATGGTGTACGCGTCGTACTTGGAGATCTACAACGAAGAGATCCGCGACCTGCTCGCTCCAGATCCCAAGAACCGCCTCGAGTtgaagga
gacggtggacgcGGGCGTGTTCGTGAAGGATCTGACGTCCCGCCAAGTCGCAGCCGCGGCCGAGATCGACGCCGTGATGCAGcagggcaagaagaaccgc
agCGTCGGAGCCACTTTGATGAACCAGACGTCTTCTCGGTCGCACTCCATGTTCACCATTACGGTCGAAGCGTGCTCGACGGCACAAACCGACGCCAATA
GCAAGCCTCACATTTGTGTGGGGAAACTCAACCTCGTCGATCTGGCAGGGAGCGAGCGGCAGGCCAAGACCGGCGCCACGGGGGACCGCATGAAAGAAGC
GACAAAGATCAACTTGAGTCTTTCGGCTCTGGGTAACGTCATCTCGGCGCTCGTGGACGGCAAATCCCAGCACATTCCGTATCGCGACTCCAAGCTCACG
CGTTTACTTCAGGACTCGCTTGGTGGCAATGCGAAGACTGTGATGATCGCCAACTGTGGACCGGCGGACTACAACTACAACGAAACGTTATCCACTTTGC
GCTATGCGAACCGcgccaagaacatcaagAACAAACCCAAGATCAACGAAGACCCGAAGGACGCGAAGATTCGGGAGTATCAGGACAAGATCAAAGAGCT
ACGGGAAGCACTGGCAGCTCAAGAAAAGAACGGGCCGTCTACACCTGGAGCGGAAGGGAAATCCTTCTTTAAAGACGGTagtggcggcgctgctccTAGT
CCGCAGATCGTGGAGAGAATTGTCGAGAAGACCGTTGTAAAACGCGAAGGCGTGAGCGAAGAAGTGCTGAGGAAGTTGGAAGAGGATGCACGGCGTGAAA
AGCGagagttgaagcagaaagcACAGCAGGAAATGAAAGCTCTGCTTGCCGCTCAATCGAGAACGGAAGAGGAACGCGAGCAACTGGAGCGTGAGCTGCA
GTCTCAAGCGCAACAGAAAGAAGCCATGTCCAAGCAAAAGGACGAGATGGTCACTCAACTGGAGGCGCTTGAGCACAAACTCATTTCCGGTGGACGTGTG
CTGGGTAAGGCTGCCAAACAGGagcggcagcttcgcgaagcccaagctcgTGTTGAAGCGCAGAAGCGACAAGAACTCCAGCTTGCTCAAGAACTGGCAG
AGAAGGAGGACTCCAACATGTTGTTGGAAGAACAGTACACAACTCTGCAGGAAGCAGTGGACGACAAAACCAAGAAACTCAAAAAGCTCTGGGCAAAGCA
CAAGGCGGCTACAACGGAAATTGACGATCTCAAGGCCGAATTCCAATCCGAGAAAGAAGATATGCTCGACATGGTGCGGGAACTGACCCGCcagctcaag
ctgaagcaccTGTTGCTAAGTCACTTTGTGCCTTTGGATGAGGCGCAGGGTCTAGAGAAGCGAGCTCGATACGATGCCGATCGTGACGCGTGGCAAGTCA
GTCGCCTCGAGACGAAGCCGTCTTCTCTGCGTCCTAAACGCCCGATCTCTCGTCGCGGTGCTCGGCGAATTGAAAGTGAGTACGCGAGACGCAATCGGCT
TATTGACCCGCTGAATGTCCGCTGGCGTAGTGACAATGTGGTGCAACTGGAGTTGGAAATGCCCGAGCGTCGTACACGCGACTTTGAGGCTGCGAACGGA
ACTGGTTACGCGCTTAGTATGAACTATTGGCTTGAACGGGTTGGTGTCCCGTCGAAGGAGGACGCCGAAATCACATTTGccaacgaggtggaggtcGCTC
CGAGTGGATTGGCAAGTGGCAGGGAGAAATCGCCATCAGCGTCGAACGGAGGAAGCAAGGAGAGCAAGGAGGCGACTAAAAGGTCGTTGAGTTCAAGCGG
AGCAGAGGacaagagcaggaaaagTGCAAGCAAGAGGCCCCCGACGGCAAGGTATGAGGCTCTGAAGCTCCTTGAATGTCACCACCTATCTCTCTCTTTC
TAACTTCGTATTTGCCAATtgcagccgccgccgtcgAGAGCAAATAGATGAGTGA