Transcript Name :
Phymu_g9158
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein PHYSODRAFT_532111
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
316-335
982-987
1063-1066
1122-1140
1-292
359-958
1011-1039
1085-1098
1164-2043
293-315
336-358
959-981
988-1010
1040-1062
1067-1084
1099-1121
1141-1163
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        6697 bases(100 bases per row)
ATGGAGCCCCGCGTAGCCTTTCtgaacgacagcgacgccaacCAAGAGCTCATCACGACCAAGCAGTACGCGCGCAACATCATGgtcacgtccaagtaca
cgGTCGTGAGCTTCGTGCCTAAGACCATCTTCGAGTTCTTCCGTGTCGTTGCCAACGTTTACTTCCTCCTCATCTCGCTGTTACAGGTAAAGTTCCTCTG
CAATTTCGACAATAATAACGACTGATGCAAATCTAATTGGAATATGTAGCTGGCGACGCCTTGGTCGCCAACGAATCGGTTCACAACGGCAGGACCGCTG
TTATTTGTGCTGTTAATAACGATGGTAAAGCAGGGAAGTGAGGACTTCAAGCGCCACCAAGCAGACGACAAGCAGAACTGCCGCTCTTGCCGTGTACGTC
ATTTTGTTTTTAAGCTGTTTACTTAAAACAATAAAACACTCACAATTCGTGTCTTCCCCCGCAGATTATCAATGTTGGAGGACAGACGGAATTAATTGCA
TGGCAAGATTTACAGGTCGGACAGCTCGTTTGTGTGGAAAACCGCGAGGAATTACCCGCAGACGTGATCATTATCGCCAcatctgaagaagaaggacggt
GTTTTATCGAGACTTCCAATCTAGACGGAGAGACGAACCTCAAGCGTCGAATAGCTGTCAAACCTACAGCACAACTCGTTGGCTGGCGGGAGCTACAGGG
AGCTCCAATCGCCCAAGAAACGGTGTGCGCTTCAGCTGTTCGGCGACTACGAGGGTCAGTGGAGCACGAACATCCCAACAACCAGCTCTACACGTTCACT
GGTCGGTTAATACTGCGTGACAACGATCGAGGAGAGACAGCAGTGCCTTTAGGCCCCGAAAACCTCCTTTTACGCGGCTGCAGCCTCCGAAGTTGCGCTT
TTATCGTTGGTTTGGTGATTTTTACGGGCTGCGAGACGAAATTACTGCAGAATTCACGCGCAGCACCTTCGAAGCAAAGCAAATTGTACCGAACAGCGAA
CCGCTGTATGCTGTTGATTTTCTCGACGATGTTTGGCCTCTGCTTAGCGAGTGCAATAGCAGCTTCGCACTGGAGCCAAAAGAACGCCAACCGGGTGTGG
TACCTGCCGTTTATCAAGGAAGCGGACCAAGCGGACGACTTTatcgtcaacttcttcacgtTTCTGATTCTGTACAACAACCTCGTGCCAATCTCTCTCT
ACGTTTCGTTGGATATTATCAAGGTGCTACAGGCTAACCGCATCACGGGAGACTCCAAGATGTCGTTCGAAGGTACCCATGCGATAGCGCGCACATCCGA
ATTGAACGAAGAATTAGGCCAAGTCGAGTACGTTTTCAGTGACAAAACGGGCACTTTAACGTGCAACGTCATGGAGTTCCGCAAGTGCTCTATTGGTGGC
ATTTCCTATGGTTTTGGTACTACGGAGATCGGAcgagctgtagctgctttAGCCAGTGGGAACCCcccagcgaagaagcagagTCCAACGAAAGCGAAGG
TTAACCCTTTATTGGCTAAGGGTCAAAGCTCTGAAAGCGGCTTGAGACTGGACATCGGCTCTACAGACGACGTCCGTGACGCTGTACCTGCACATCCacc
tcaaggagaagaaggttgCGACCCGAAAGACGCGCAGGTTCACTTTGACCCTCAGATTCACTTCGATGACCCGGGGTTATTACGTGCGTTATACGCTGGA
GGCAAGCAAGGTGGACTCATCCACGAATTCCTCACTCTATTGGCTATTTGCCACACTGTAATTCCCGAGACGGACGTTAAGACTGGAGCTGTAGCTTATC
GAGCCTCCTCTcccgacgaagaagcgctggtgAAGGCTGCCAAGTGTCTCGGGTATAACTTTATCGCCCCTGCTCCGCTCATGAAGGTTGAGATTTCGTG
CAAACCATCGTTACTTCCTGCCAAAACCGGCGTACAAGAGCCCCGGACGAAATGTTTCACTATCGTGAACGTGAACGAGTTCAACTCGACCCGTAAGCGC
ATGTCCGTTGTGGCGGTGAACGAGGAGACCCACGAATACGTTTTGTACTGTAAAGGCGCGGACAATATGATGCTggagcgagctgcagctgaaaaaAACG
ATAACGATACTGCTGCTCATGCGAAACTGGTAGGACATTTAAAGAATTACGCACGTGAAGGTCTACGAACGCTGGTGCTTGGTCGAAGAGTCTTAACGGA
AGAAGAGTACCACGAGTACAACGAAGCGTACATGGCTGCTTCGACAGCTCTGGACGACCGTGAAAGGAAACTCGATAACTGCGccgagatggtggagaag
aacatGCAGCTATTAGGAGTGACAGCTATTGAGGATAAACTGCAGGACGGAGTTCCCTCTGCCATCTTCGATCTCGCACTGGCTGGTATTAAAGTCTGGG
TGTTAACTGGAGATCGGGAGGAGACTGCAGTCAATATCGGCCATGCTTGTCGGTTAATTAAcgacaagatgcagctgctgtacgtgaaTGCAGAGCGTAT
CGACGCTCTTAGTGCGCAACTGGATGCTCTACATGAGACTCCCGAGATCCAGCGGCTCATTCGAGGCGGTCAAATGGCTGAGAACCTCGCGATGGTCTGT
GACGGCAAAGCTCTCGTCCATATCTTCCCGTCCCGTGATACTCGCGTGAAATTATCCACTGAAGCGGTTCAGCGGGTAGAAAATCTAAGCCAAAAGCTGT
TGGATATCGCTCAAGTATGTAAAGCATTGATCGCCTGTCGAGTGAGCCCATCGCAGAAGGCGGAGATCGTGCAGCTTGTACGTAAGGGGGCGCGTCAGGA
GCGTAAAGCTCAACAACCGATCACTTTAGCTATCGGAGATGGAGCTAACGACGTGAGTATGATTCAAACAGCTCATGTTGGAGTCGGGATCTGTGGGAAA
GAAGGGGTGCAAGCTGTGAACGCCAGTGACTACGCGATCGCTCAGTTCCGGTTCCTTACGAGACTGGTACTACTGCACGGGAGGTGCAACTACAAACGTG
TGTGTAAAGTCATCCGCTACTCGTTCTACAAGAACATCGCGTTAGTCAtcagcctcttcgtcttTAACTTCTACAATGGCCAGTCGGGCGCTCCTctctt
cgagagcttcgtCATGGCAGGctggaacttcttcctggcgCTACCGATCATCGTGATCGGGATTTTCGACCAGGATATATCCGAAGACGTGGTGTTAAAG
TTCCCGCAGCTCTATCGACGCGGCCAGCATGACAGCGACCTGAATATGCGCGTGTTTGCCAGGACGATCCTTAATTCAGTAGCTCACGCGttgatctgct
tcttcggaTGTTACGCTGGCAATCGGTACACCAACTACGGGCTGTACGTCGTGGGGACGCTGTTCTACACGACGTTGCTAGGtacgatgaagctcaaggt
CACTCTACTGGCGCTCAACTGGAACAAGTACCACCTGGCAGTGCTGGCCTTCAGTGTCGggctcttcatcttcttcttgttggtgtACCCGCACTTCACC
TTCATGAGCTACGACATGTTCGGCGTACCAGCGTACATGATCACGCTTCAACGCTactggacgctgctgctactgtgCCCCATAGCGGCCATGACCATCG
ACTttacagctacagcagctcagcagcagttccgTCCTACAGCGGAGGATATTCTTCGAGAGAGGTTTCGACCGGGGAAGTCGAAGCGTGTGAGCGACGC
TGTAGCTCCAATGACGTTAGAGCATGGCTCCCCCTCTGTTggcaagctcttcgtcgcagAACAGTCTGCAGACGAAGATAAGAGCGACCGTAAAGGCAGC
AAAGAACAGACGTCCAACGCGTTCGTAGTCACGGCTCAACCCCCTTCTCCGAACCGAAGAACCGGCAGCACCAACAACCTGCCGACGTACGACTCGTTCC
GGGGTAGTTTGCCTCAAGCCCAAGCCCGTACGTCCCGCAGTCGCTCCAGCGTCGCTCCTGCTTGACTGACTGACAATTTCTTGTACGTTCGTTTAAAACA
gggagcagcttcgccttcaatGGATTGGATGGTGTTGCAGGCAGACACGCGTCGGGGGATCTGCCAGCGCAAGAGGCAGTGACGATGAGAGTTTTGAGCT
TCCAGAAGCACCGATGACCCAGTAGATCCAGCTCGCTTGGTCGTCTTCCCCTTGTAGCGACGGATCTAGTGTCGAAGCGAGATAGCGTCAGGAGAGACAT
ATAAAAAAAggaaaatggctacattatACAACtatgatacatgtagttgaagtgacctTCATTCATCAATAATTCACTTAAGTCAGTACTAACCTTCACT
CAGCTTTAACATGAACCAATCAAAATCAACCGATTATTCGCCAATATGGTCGTGTACGCGCAGGTGCTCAGCGTTGCGTCCCTGGAGACGGCACCCAGCC
TTCTGCTGTCCACGGAGACGAAGCGGTGCGTTAGCTGACATCTCTGGCTAGCTCTGTGCGACGTCGTTCCACTAACCCTCGTCTGGCGGCTGCGCAGTTT
CCTCTTTAATGTCGGCGATGGCACGCAGCGACTGTGTATGGAGCACCACGTGCGtctggccaagctgcagcaggtttTCCTTACAGAACTGCGGTCCCAT
ACAGTAGGAGGACTCCCCGGGATGGTTCTTACTGTCTCAGACACGGGAAAACCAGGGATTAATGTCAACGGACCGCCTGGAACCAAGAAGTATCTAAAGG
CTACGCGCCACTTCCTGTACCGTCCAGACTTTAAATTGGAGGCTACAGAGGTGTCAATTGCCGACGAAAAGAAGGGTACAAGCTGCtatgaagatggcga
agtGGTGGTACATGCTGTTGCCGTGGAGAAGCCAAAAGCGGGGGCGAAACGAAAGCTGAATGAAAGCCCTTCGTCATCGGAAAGTGAAGAGCTGAGTAGC
CATGTGAGTGTCAGCTACGTGGTGGAAACGAGGCCTCAGAGAGGCAAGTTCTTGGTGGATAAAGCGAAATCTTTTGGTGTTCCTAAGGGCAAATTGTTCG
GACAACTGCATCAAGGGAAGGATGTCACTCTGCCTGACGGACGAGTGGTCAAGTCGAGTGACTGTGTGTTGCCGTCAGtacctgctgctggatgtgtCAT
TGTGAGTTGTCCTACTGCAGCGCATGTGGATGCTCTGGTGGCTAGTGACGGCTTTAAAATGTACAGGGAAGTGGACGGAAAGGCAGAGgtgcaggtggaa
gtggttTTCCATCTTGGAGGCGTGGAAATACTGCGCCACCCGAAGTATCAAGAATGGGCACGGAGTTTCGGTGCTCAAGCTCGTCATGTGCTGCTTGGAC
ATGGTTCTTGCGCGCAGAAGACGGTGTATCGTGCGTCAGCGAAGCTTCAAGCCCAGCTACACGCAGCGTTTCCGCACGCATTCCCTTCGAACGAGGCGCA
CGAACTGAACGACACGATTGAACCCTTCtcgcgtgctgttcctgaCGCTTCGTCATTGAAACTCTCTGCATCCAGTGAGGAAAACGTGAGTTCTGATCCA
GCATCATCGAAAGTGGTTCTGGGCGAGAGTATGCTCAGGTTCATCCTCGCTCCACAAGCTCGACGCGGTTTTGACTCGTCCCGTTGCTGGCCGCGACTCG
ATTTCGACCAGATCCGCGAGAGTGTGGAGATTGTAGCCAAGATACCCGACAACTCCAGTGGCAAGAGTCTGGATGAGGATCTTCTCGACGGTCGGATCAC
TTTCCTCGGCACAGGGTGCGCCATTCCGTCCAAGTACCGCAACGTCACAGGCATGTACTTGGAGCTGCCTATTGGAGGCGACTGGGCTGGACTGATGCTG
GATTGTGGGGAAGGCAGTCTAGGTCAGTTGTATCGCTACGCCAACGGCGACAGCAAAAGACTGAAGGAACTGGTCAACCGCCTTAAGTGCGTCTGGATCT
CGCACAACCACGCGGACCACCACTTGGGCTTGCTTCGGCTGTTGAGCCATCGTCCGGACGACTCGAACACGGAGCCGTTGCTTGTGATCGGGCCGACGCC
GCTCCGGTTCTGGCTGGACGAATACACGGAGCAGGACCCGACCGTGCGAGGCAAGTACGCGTTCGTGGAGAACTACAGCTTCGACGAGAGCGACTCCCGA
TGCGAGGACGTCGATATCCACGCCGAAGCCGCGCGCGTCCGTGTCTGGTTGAAAGAGACGCTGAATATCTCGCAGCTTGAATGCGTCCCAGTGaagcacg
cgctgcagtcATACGCCGCCGTAGTGACGTTCGTGGACGGCTCCAAGCTCGCGTTCTCTGGCGACTGCCGTCCGAGCGACaagctggcggagaaggccaa
gggcGCGTTCCTGATCGTGCACGAAGCCACgttcgaggacgagctcacgcaagaagccaaggacaaggcgcACTGCACGATGGCCGAGGCGATTGAGGTG
GGGCGGCAAGCGAACGCCCGccacctgctgctcactCACTTCAGCCAGAGATACCCGAAGATGGCGGTGCTTAGTGCCAccgatggagctgcagaagcca
TGGAGGTGCTGACAGCCATCGACATGTTGTCGCTGCGGTTCCGAGAGCTCCGCCAGCCGAGCTTGATGGGCGTCATGACGCAGCTCATGGCcctggacga
cgaagaagacgtcgacgctgcgcaGAGTCTCAAGGCTCAACAGGAGCGCgaagagaggaagaagcagaagagtATCGAGCGCGGCGAAAGACAGTAA