Transcript Name :
Phymu_g7372
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_558741
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EF-hand domain9.966PS50222
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-212
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
calcium ion bindingGO:0005509IEA
*** None ***
*** None ***
Sequence
        779 bases(100 bases per row)
ATGTCAATCCACATGCGTTCGCAGCTCTGTACGTATCCCGCAACTCACTCTCACTGCCGTATCCCTGTCTAATTGCATTGCACTACGCGCAGTTCTCATC
CGCCCGCAGTCCATTAAGCTCGCGGCGCGTGCCATGTcttcggccaagaagctgcagagccGCAGCCAGGCCCTGGCGCTGAGGTTACCAGCGCGTACTC
TGCCCCGTACgccgcagctcgtcgtggCAGGCGCTGTATTGAGCGCGTCAGTGTCGCTGTTGCTTAAGGAGTCGGCACTGTGCCAGGACGCGATGCTGCT
CGCAGCTTCAGTGCGTTGGATCTGATCTGAACGTCTGCGAGACGTTTGCCATGTAATTTAACCACTGCAATCTTTGCAATCTTTAGGAGGGACCATCGGG
GAGCGgaaagcccaagaagaacgatTCGGTGGAGCACATCATCGATGTGGTGCTGGGAAACTGCGGCGAGCTCACTCTGGCTGGCAGCCTGGGTTTCTGC
TCGGGCTACGCTCTCAAGACAGTGGGGAAGGCTGCGGCAGTGGCTGTAggcatcgtcttcatcctggCACAAACTGCTGCCTACAACGGCTACATCGACA
TCAAGTGGAACAAGGTGCAGAAGGACATGATCGCCAAGGTCGACCCGAACGGAGACGGCAAGATCGACAGCGAGGACGTCAAGCTCTGGTaccggaagct
gctcaaggccatgaagacgaatCTGCCGTCGTCCGCGGGCTTCTCCAGCGGTTTTGCGCTTGGCATCTACTACTCGTAG