Transcript Name :
Phymu_g5670
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Heat shock factor (HSF)-type, DNA-binding1PR00056
Heat shock factor (HSF)-type, DNA-binding1PR00056
*** None ***
HmmSmart predictionP-Valprediction_id
Heat shock factor (HSF)-type, DNA-binding7.3SM00415
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-365
NN-scoreoddsWeighted Score
0.7553.3970.007
*** None ***
TypeScore
nuclear739
GO
Biological ProcessGO IDPrediction Method
transcription factor activity, sequence-specific DNA bindingGO:0003700IEA
nucleusGO:0005634IEA
regulation of transcription, DNA-templatedGO:0006355IEA
*** None ***
*** None ***
Sequence
        1662 bases(100 bases per row)
ATGGCGTCCGGGGGCGGCGTCCAAGTCAAGGGAGAagccgcttcctcctcgttACAGGACGCGGGCGACTTACGTCCGCTGCGGATCCGCGTCTCCACCC
CAGTATCCCCCAATcgcgacagcttcaacactCCAGATGGCAGCGAATCCACAGCTTCCGGTCGTGGCGTCAAGCGCCCGAGGCGTGAAGAGGCCGCGTT
GTTCCTGGAGAAAACGTACGAGCTATTGGAGCGCTGCCCTCCCGAACTGGCTAGCTGGACGGCAAAGGgcgacagcttcgtcgtGAAACAGCCCTCAGCC
TTCGCGGAGCACGTGATCCCGACGTACTTCAAGCACCGCAAgttcagctccttcgtgcGGCAGCTAAATCTCTACGGCTTTAGGAAAGTGAGAGATTCGC
CAACAGTTGCGGTCGACGATGCGGACGTTATCGCGGTCGAAGACGCCAGCCCCAAAGATTGGTGGGAGTTCCGTCATGAACGATTTGTGCGGGGAAGGAG
AGATCTGCTGTGTGAGATCAGAAGACGATCTCCTAGTGATGCCAGAGTTTCAACACCGTTGGGGGCGGCTACACCTGTGGAACGCGTTGAGTTCGAGGAG
CTAAGAGGTGAAGTGATCGGTCTGCGTGAGGATATGCACAAGATGCAAAAGACCAATCAACACCTAACGAGACTGCTGCAAGACCTTTTACAGCGATTTC
CTGGAGTCGAGAATGACGGAGGGAAAAGCGTCAATAGGCAGGAGTTCATTCAAACGCCAAGCTTTGCCAACTCCCCCTCTGTCCAACCTAGATCTCTGCC
TTCAATAGCGTTACCCAGTCCAACAGCTAGTGGCAGCCTCAGCGGACCTCAACTAGCGCTACTACAGCTCCGGCAGGGACTTCAACCGCAAGGAACGCCG
CGAGGCATTTTGACACCTCGAACACCCGCCTCGGGGTCTTTTCATTTACGACCGGTACAGTCGCTGATGGTGAATCTGAGCCCCAGCACCCGGCCAGCGC
CTAGTCCGCGACCAACTGATAGTTACGTTGGCACTCCATCGtacagccaccaccagcatgAACAGCTCAGCCAACGTTGGTACCAAACCACTCCACTTAC
TCACCGGTCCCCGACAGCAAAGCGTTCGCCTTTAAAGCGAGTGGGTGTAGACTCTGCCACTCCCGTTTCAGAAGCCCAGACGACTTACGGTCTCCGTTCC
CCCGAAGACGTAGCTGTCCGTGAACTAAGCCGTATAGCCTCGGAAATCCGCGTCGACCTGCTAGCTTGCATCACTGCGCGTGTCACGGGCTTTTTACGCG
TGCATCGCGATCAAACGGAACCAactcgagaagcagatgctGATGCTGTAGCCGAAGCTGTTGGCTCCGACATCTGTCAGAagctcacgctgctgcaagC
TTCAACGACTACATCAGACCCGAAGCTCTTAGACGCAGAGACAACTTGCATGTACCGCGTGGAGATTTTGAAATTCATTTCGCGTGAATTGCCGCGTGCC
GTCCAGGAAGCCGTCGACAAGCGACTGCCGACACCGGAAAAACTTAAACAACGCCCAGCGAAAGACCGATCACTGCTCGCGTTGCTCGTGCAAAAGGCAC
AGAAAGCGCTGGAACGCCAAATGCACACGGAGACTGCCGCCGTCACTACAGGGCGTCGATGA