Transcript Name :
Physo_344600
Orientation:
(+)
Number of Exons:
4
Description :
Eukaryotic/viral aspartic protease, active site
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-975
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3321 bases(100 bases per row)
ATGACGGGCCAACGATCCAAGAGGCATTGGAGGCAGGTGCGCAGTCGGCTGGAAGGTCGCCGACCGCAAGAGAGCACAGTGAGAGACCTGTCGCGTCGTG
GAGCTCTGTGGGAACCTTCACGACAGGACACGGGGCCAGCGACGACCAGGAGGGCTACGAAGAACAGTTTGCCGTTCCCGATGCGGCTCCCGACGAGGGA
GCCGCGAAGGGCCGCGACGCAAGTCGCGGTCCTACTGGTCGGAAGCCTGCAAAGGCCGACGACCAACAGCAACCCACCGCCAAGGCCGCCGCCAAGCGCA
AGTCACCCAAGAGGAGGAAGAAGAAGAAGCTGCGCGTGCCGGACTCGGCGGAAGCGTCGCTGTCCAAGCCGCAAGGCAAGGACGCGGGGCGCCAGTACAC
CGTCGAAGAGGTGCGGTACGTCGTGGCGCGCTCTGAGCTCGTCTGGCTGCTGGAGCAAGACCCGATCTTGGTCTTCCTCAAGCCCATGCTGATGAGCAAT
TTCACGGGCCCCTTCGTCGCGCCGGACTTCGATAGTCTCACCAGCGTTGCCCACGCCGCGCCGACTCTCTTCCAGATGCTGCGTGACTCGGGGTTCGTGC
TGGGATCTTTCGAGATGGAGGAGCTGTGCGACTGGGACCTCAAGATGCGCGCGATTCGCGTCGTGCAGGAGCCCTTGACGATTCTCGCCGGATCCGTCAA
ACAAGACGCGACGAGTTTCTCAGCGGGCCAAGACGCGCCGAGTTCCTCGACGGGCTCAGCCCAGACCTCGACGACCACGCCCTCGCCGCCACCTCGATAC
CAATCGAGCGTGGACTCCGACAGCAGTTTCGAGTCGCCCAAGCGCATGCCCATGAACCGGCCGCCGCGCGTCATGCAGCTATCCGCGGCGCCCACGCGCA
CAGAGGTGACGAAACCCGCCGAGGAGGTGCTTCCCAAGGCCTTGAGAGAATCTATCATCAGGCTGATGCAGACGACAGTGATGAACACCCCGCGCGCCGA
CACGGCCGCAATTCCGACGGGGCCGAAGCCGCCCTCGAATCCCACACCCACGGTGGCTCGCCCCCAGGAGGCAGCGGATGTCGCCATGGAGTCGGTCAGT
TCGCGTTCTTCGACGAGGTCCAGAACTCGACGCGACGCGGACGAGGGCCCCGATGACCTGTTCGACTTGGACATCGAAGTGCCAACAACCGCGGCCGCCG
TCGCGACGGCGACAGCCGGCGGCGTAGCCCTCGCCCGCGTACGCCTCTCAGCATCTTCCGAGCTGAAAGAATTCTTAGGACGGGACGCCAGCGAAGAGAA
AGCCAGACTGTGGCTCAACCGTCTGAAGTCCGCCGCGCGGCGCGACGGGATGACGGGCGAAGAAGTGTGCGGGCAGTTCAGCGATCTAATGAGCGGCCCT
GCGCGCCAATGGTATCTCCAGTTGCCCAGGAAGGTCAAGAAATCATGGACCGAGCTGATGGAGCAATTCCGGGTGCAGTACTGCGGCAAGGGCGTGTCAA
TGGCCAGTCGCTACTACCATGCGGCTCAGCGCCCCGACGAGACCCCTCTGGATTACTCGTACCGGCTCAACGTCGCGGGCATGAGGGCCAACATCCCATA
CGCCGAGGGCACGACTGAAGAGAAGCGCGAACACGACGAGCATTTCATCCGGACGCTGAACACGCAGGAGGCCGAACTCGCCTCGCGTCTCACGCTGATG
GAGGTCGCCGACTCCGAGGCGCTGGAGAAGAAGCTGCGTGCCCAACAACGTGGATTGGTTCACCAGAAAAAGACTCTCTTCGGCTCGAACAAGTTCCGCC
AAAAGGCGCCGACCCCGCCGACTCAGCCGGCGCGCGCCGTGCATGCGATTCACGTCGCGCCGGACGAGTACGACTCGGAACGCGAAAGTCGCGACAGCGA
CGATCGCCAGTACGACCAAGGCGAGGCGGACGAAGAACGCGCCAAGTTGTTCGTCGCGGGACAGGCCCCGCCGGGAGAGCCGGCGCGTCGCAACTTCGAT
CCCGACGACTCGGGACGCGACCGCCCGTGGTGGTTCACGTCGCCATGTCGAAGGAGACTGCTGGAAGTTGTTGACGTGTCAGAAGTGTGGTGGCCAGCAC
CCGACGGAGCGATGCTTGAGGGTGTGCAAGGCCTGCGGTGACGTGCACAAAGTCGGAGAATGCCCGATGGAGGAGTTCTTCAACCAATTGCGCCAGTGGT
TTGACCCGAATAAACACGCGGGAATGCTGCCGCCGGCCGCCGAGAAGATGTTAAACTAGGCGCTCGCTGGCTTGGAAACCAGTACGAGACGAGCGACCTG
TTTCCGTCTATGCATATGTGACCAAGCAGTCGCGAGAGGTGGTTAGTGAGAGCCCGACTTCCCTGAATGATAATACGTGTGAATCCAACCCGGAACGTAC
CACGCAAGAACGCGCGCTGCGAATCTCGGCGGTCCGACGTACGACGGACGACGAGTTTGCACGTGAACCACCCCTGGATGAGATCGACTTGCAACCAGGA
GAGCGACGCGGATACTGGAAACATCACGCGCCGCACAAGTGGTACAAGCAGGCCAAGATTCATGGAAAGCTGAACAACTGTCGTGCTGTGTTATTGCTCG
ACACAGGTGCCGAGGTGTCCATCCTGGACACCACCTTTGCTCGTGAGGTAGGCTGCCTGATTGACACGGAGATCACGCAAGAGTGTGCGGGAATTCGTGA
TGAGACATATTACACGGTGGGGATAACCAGAGTCAAGATTACCTTGGCTGGGAACTTGGTGTACTACATGCACCTGTGGGTCGGCGACTTGGTCGGCCAA
CACGCAATCCTGGGAATGAACTTCATGGTGCCCGCTGGAGTGCGCATCGACACTGCGGATGGCACGGCGTGCCTCCCCGACGAGGTGCATATCCAGATGA
TCGGACGAAGACCGCTATACGGCGCATGGATGCACCCGGTCAACGTCAAGACGCCTGTGAGGCTCGAACCAGGAGACACGCATGAAGTCTTGCTGAGGCC
AGATCGAAACGCGCCGTTCCTGTGGGTGACACGGGCAGAGTCGTGGCTGACTACCTTTGTCAAGGGGAGAGTCGGAAAGAAAACGTACCTGCGTGTCACG
AACATCGGAGACGCAGCGATAACCCTCGACGCGCATGAAACGCTTGGGTGGTGGACGCCGTCTGACGGCCAGCCTCTGGATTCGTCCGACTGGGCTCCAC
CCGGTACCAGCAGTGGCAGAATCTGGCGTACGGCGCGACGCGCGACGCGGAGGAGAACTGGATCCCAGCCGAGCTCGACGGACCGATGACGGATCGCCCC
TCATACCCGACGCCTAAATAA