Transcript Name :
Physo_248056
Orientation:
(+)
Number of Exons:
2
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-425
NN-scoreoddsWeighted Score
0.8131.530.003
*** None ***
TypeScore
nuclear565
GO
*** None ***
*** None ***
*** None ***
Sequence
        1536 bases(100 bases per row)
ATGAGCTCGCCTCAGAAGAAGACCGCCGCTGAAGCAGAGGGGAATACCTCCGCCGGGATAGAGACTCTCTATATCCCCGAGTACCTAGAGCGTCACAAAG
CAAAGCGTGACGCTCTTGCTACCAAGGCTGCGGCGGGGACAACTCAACCGGAGATTGTCCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGACTTCGA
GGACGGCGTCGTGGAGATGGAAGAAGGCGAGGCCTCTTCTAGCAAGCGCAAGGAGTCTATCGACAGCGATAGTCTCGACCCGCATGCCGGGTCGAGACGC
GCTAGTGAAGGAGACGACTCGGACGCTCCGAGCTCGAAGCGTTCGCGCGGCGAGAAAGAAACTCCGCTCTCTGCTGCTGGGGCTTTAAGCTCCCCGTGTG
AGGTGGCGACTTCAAGCTCTCCGCGCGCTGCCAAGGCAGCGAACGATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTTGGCAACACTATGCC
TCCAAACGAAATCCCGCTGTACGTATGCAGCGGGATCCACGACGATGCTGTTGCGGAGGAGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCGATTAT
TATATCGGGCTCTTCCACGAGCTCCGATACTTCTCCAGCAAGAAAACTTCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAACG
CTTTTGTTGAGAACTTCAACAAGAAACCGGCTGCTTACCGCGAGCGGGTTAAGCATGCCCGTGAACGCTTCGAGACATTCTCGACGCACGGGCGGCTGGA
GCAGCTCCACAGATCCTCTGTGGACGCTGGTATTCCGTGCGCTGTGCCCGAAGGCCAACAGTGCACGTTGTGTCTTCCGGGTGCGGTGCGCTTGAGCGAC
CGCGACCTAAACGGGTACACGACGATTCGTGTACCTGCGAGCATCAAGGAGCTCCGTGCCAAGTTCTTGGCACGCGAATAATGCGACAACCGTGGGACTT
CGGGCGCTGTAGGTGACCACAGCGCTCGCACTACCTTCGCGTCGGCAGTGCGTGGTGAGCTCCGTACTCCCTCACCATTTCCGGAACGTCCTACAGCAGG
ACGTCCCGCGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCTCCAACGAATACGATAACGAACCGGCTGCCGGTTCGTTTTCGGGATACTATGGTTCA
CAATACACTCAACAATCTAGCGTGTTGAGCCGCGGGCGTCGCGGATCGGAGGCGGCGGTGGTGGGAACACGTCACGGGTATGGTCAACCTGGGGTTGACC
TTGGTCCGACGCTCGAGGATCGGGTCGCTGCAGTGGAGCAGCATCAGAGCCGGGAGTTCGCCGCTCTGAAGCAGGAGGTGGCGATCCTGAGGGCTCAAGT
CGCTCAGGGCTCGCAGACCGCGTCGGACATCTCTGTCGACGTGGGAGGTCGCGTCGTGCGCTTGGCCCAGCGCGTTCACGCGCTGGAGCAGAGGTTCGCT
CCCGCCGGGGCTTCCGCTTCGGGCCAGCCGAGCTAG