Transcript Name :
Physo_534848
Orientation:
(+)
Number of Exons:
12
Description :
DEAD/DEAH box RNA helicase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, FYVE-related11.258PS50178
RNA helicase, DEAD-box type, Q motif8.938PS51195
Helicase, superfamily 1/2, ATP-binding domain32.314PS51192
Helicase, C-terminal23.027PS51194
HmmSmart predictionP-Valprediction_id
FYVE zinc finger5SM00064
FIST domain, N-terminal0.0017SM00897
Helicase, superfamily 1/2, ATP-binding domain7.1SM00487
Helicase, C-terminal4.2SM00490
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
FIST domain, N-terminalIPR013702
Zinc finger, FYVE-relatedIPR017455
Helicase, superfamily 1/2, ATP-binding domainIPR014001
RNA helicase, DEAD-box type, Q motifIPR014014
*** None ***
InsideOutsideTMhelix
1-2125
*** None ***
*** None ***
TypeScore
nuclear957
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
metal ion bindingGO:0046872IEA
*** None ***
Cluster Id
468
Sequence
        7848 bases(100 bases per row)
ATGAATCAGGACGTGGCGGTGCCCCCAGCGGCGGCTGCAGCTGGAGCAGCAGCAGCAGCGGCGGCGGCGGCGGCTAATGACGCTGCGGAAGACAAGAACG
CGGCCGCGGACTGGAGCGACTCGGCGGACAACTCGAACTCGCAGGACGACGAGTTCCTGCCGCAGCCGCAGGGCCCGTCGCTCTCGTACGAGCGCAAGAT
CCGGCTGCACAAGTACGCGGAGAACCGCGCGCGGTCGTGTCTCGGCCTACTGGCGGACTCGAGCAACGCGCTGTGGAAGGTGCACGACTGCAAGAACGAC
ATCGGCGTGTACAAGCCCAGCTCCGACTGGTCCGAGTCCGTCTCGGCCAAGGCCGTGGTGTTTGCCAACGCGGCGTTCCCGAACGTGCTCAAGACCATCT
ACGACCTCAAGACGTCAGACAAGTTCAAGCTCTTCATGCGCAAGGTGCTGGGCGACATGTTCCTGGACGCAGAGGTGCTCGAGGACCTCAACGGCACGGG
CGTCTACCCCAGCGCTAACCCACCGCGGGACGCGCGCGAGATGTACAAGCAGGCGGCCATCAAGTGGTGGGCCATCAAGTCGGGCACACTGGCTAGCAAG
TCCTCCGACTTCTACGTGCTGGAGGTAAGTGCAGGCAGCGACGCAGCAACCGGGTCGCGACGTGACGCGCGGCGCAGCATTTCTTCGATATTCCAGCCGT
TACTTACAATGCTGGCCCCATGACGGGCGGGGCTTCAACTGACGATGTTGTGCTTGTGTGTGGTGGATTGGCAGTACATTGGTATCGAGACGTCGGGCGG
GGATATCGTTGCATGCTACTTGTTCCAGGAATCGCTGGCGGAAGTGGGCGGCATGCCGCACATCCAGGGCAACAACCTGGAGCGGTCTCAGTTCGACGCG
CTGATCTGCAAGTTCGAGCGCACGTCCTCGCCGGACTACAAGGACGACTTTGTCACGATCTCCATCGCGTTCCAGCGACCTCCGCCCATGGTTAGCCTTT
TCCGCAGCAACCCTGCAGTGGAGATGGTCACGCAGCTCGCACGGGGTCTTCGCGACTTGCTCGAGGACCCGCCAGAGCTGCAGGAGATCTCTGTTGTAAA
GACGTCCGCTTGGGTGAAAGACAAGTACGTTGCGCCACCTCCTGCCGTTAGCGGGGGCATCTTTCGGTTGCATGTATTCGACTTACTTAATGAGCATTCC
TTTCCGCCTTGCATTGATGCAGAGAACGTCGCTTCTGCGTGCTTTGCAATCGCCGCTTTTCGCCGATCTTCCGGCGGCGTCACCACTGCCGGACGTGTGG
GGAAGTGATCTGCTGGGCCTGCAGCAGCACCATCCGCGTGCCCTCGATCAGCTTCACGCACAATGACACAGGTAAGCAGGTGCTGTCGCGCCACCAACCG
AGTATCCGCGTGTGCAGCAAGTGCGTGGTGTCCCACCATCGGTCGAAGAGTGGGAGGGAGCTGAATAACCAGGAGGACTTTAAGGACTGGATCCAACGCA
GCACCGAGCAGCAGCAGCTCGCTGCAGGCGGCGAGCCGGGAGGTGGAGTGCAGCAGCTCCGACTGCCCAGCCCTTCGCACTCCCAGGACTTGTCAGGTGC
TTTGGAAGCCCCGCTCGATGAGAAGGAGCAAGTTCCAAGCTCCAAGGAGGAGCGTATGCCTCGTAAGTACCGTCGCATCAGCTTGGACAATGAAGAGGAG
GAAAAGGAGGATGGAAACAACCGCCCTCACCACCAGTATCGTGAACTTCCAGATACCATTGATGATCGGCAGCGCCGCGATTCGAATTTGCGGACGTCAC
GCAAAGTCTCTAGCGGGAAGCAGCGGCAAAGCAACATGCAGCTGCCGCAGCGCCACAGCTACGGTGAACAGGCAGCTCGCGGTTCCAAGCATATGCGCCG
GGTGCGTCGATCTCACTCCGAAGTCAGTGTCGAGCGCGCTACCGGCCACGGCCGGGATAACCAGCTGAGTGTGGCCAAGCCCGTCGCCACAAAGAGCAAG
AGCCCAGGTAGCAGAGGACGTCCCACCAGTGCTGGTCGTCGTGGTCCCTCGCAGGACCCCGTGCGGCAGTCTGTGCCACCAAGTCACGACAATCAGGAGG
AAGCGGAACGGAGATCAAGTTCGATGGAGAGACTGCCCGTTCAGAACAGTAGCAGCTACGTTCATGCTGCATCTGCGTGGGCTACGAACAAGACAGAAGT
TCTCGCGATGACTGGTGCCTTTCAGGAACTGATGACAAAGCTCGGAGGTGATGTCCATTTCGTGGTTGTCGGCTTCTCCACGGGTTTTAGCGCTGAAGTA
ATTGTTAACCTGCTTCGCCAGTTAGCTCCCGGGGTGCCCTACATCGGCGGTACGATCGCTCGTGGCATGTGTGACGAGAACGCGTGGGTGTCTGTGAATC
GGCACAACGATGAAGGGCTTGTCACTCTATGGGGAGTGAATGACCCCCACGGAATTTACTCCGTTGTCCACGCCGAGTACTCGCAGAGCGACGCACATGA
AAAGACGTATGCAGCGGCGAAGACTGCATTTGCCCGTGTAGCAGGTGACGTGGATGCTGGAGAAAAACCGGCATTTATCGCTACGTACGCGTGTCCGCTG
TTTGTAGAGCACGCGATTGACGGTATCCGCGAGGCAATTCACTGTCCGATTATCGGTGGATGCTCTTCAGACGCCACAAGGCACGGTGAGGGTGAGGTAT
CGGTCTCTTGGATTCAAATCAGCAGTAGCAGTAGTTCGGACTACACGAAGAGTGTTCGTGACGGGCGAGGTGACTGGACGGAAATGGGCATCGCGTTTGC
GCTGTGCTTCCCGAGTGTGGAGACGTACGTCAGCTGGTTTAGCGGCTACAGTCCGGTCGGAGTAAATAGCGAATACTGCATGGGCACAGTCACGAAGGCA
TCGAACAAGACGATCTACGAGATCGACTGCAAACCAGCGGCGGAAGTCTATCAAGAGGTAATGGCTTGGTTTATTAACTGTATGGAGTCACCGACATCAT
CTAACTCATTGTTGTTTGATTTTACAGTGGCTTGATGTTGCGTCAGACAAGAGCCAGACTGAGCTCTCTTCAATCGGGTTCCCTCGGCTCGGCAGCCTGC
ACCCACTGGGCACTACGATCGACTTCGTGTCGAACCAAATGGAGATCGACCGCAGCATCGACGCCAACTCTTCGTCCTCGCTCTGTTCAATGCAGTCGAG
CGATTGGTCCAAGCTTATCAACATGACGGCGGTGATCACTGGCATCAACGAGGATGGCTCACTGAGCACGACCAGCTCAGTTGCCTCCGGCACGAACGTT
GTGCTGATGGAGACCTCCGCGCAGTCGTTGAAGACCGCCATCAACAAGGTTTGTGCTGCTGCGTTGTATTGGACCTACTGGATGATAACTGACCCCTTCT
GCTTTGACGTTTGTTGTCCAGATGGGAGCACAAGCCGTGGAGAGCAACAAGTTCTACATCCACGAGACGATCGGCTGTCTGATGTTCCTGTCGGCCGGAG
TGCAAGCTCTGCTAGGCCACAAGAGCATGGCCGAGATGGTAAGTTGCCACTGCTTGTACCTCATCGCGCTGAATGTCTTCTAACGTGCTGTGTACTCTGT
GACGGACGCAGGTTGGCGCGTATAAGGATTGGTCGGGCGGTGCGTCGCTCATGGGCATGACGACGTTCGGCGAGATCGGGCACCTGCCCAACTCGAACGA
CTTCCCGCACTACGACTCGCTCATGTTCGGCGCCATCATCTTCTCCAAGCGCAAACGGAAAGAGTACCTCTACTTCTAAGCGAGAAGGACAGCAACTCCC
CAATTAGTGTCCACTTTTGTCCTCCAACGTCTATTATCTTTTCCGTCCATTTTTGTGTGACATCTCTATTTCGTCCAATCCCCTTCCTCTGAATCCGCAA
TATTACCCAATGACCAGATCGGAAAACCGCCGCCGCCTCCGCCTTCAAAGTACCAGCCACGGATTTCCTCATTATCCAATTTCCACCGCCATGGCGCAAG
ACGCCGCGAGTCCCAGTCGCCACCGGCGGCGGCGCAGTCGCAGCAGGAGCCGCAGTCGCAGCAGGAGCCGCAGCCGCAGCCCGAGTCGCGGCCGCAGCTC
GCGCGCGTCCTCCCGGCGCCACGGCGCGTCGTCGTCGTCGCGTCGCAAGCGCTCGAGGTCCCGCTCGCCGTCGTCCGCCAGCGGCGCGTCGCGCTCCAGA
TCGCGCTCTCGGGAGCGGAAGCGCCGCCGCGCGTCCAAGTCGAGCGACAAGCACCGCAAGAAGCGCGCCAAGAGCGACCGGCGGGAGCGGCGCCGCTCGC
CGTCGCACTCGCGCTCGCGCTCGAGGTCGCGCAGCCGCTCGCCCAGGAGATCCAAGTCCAAGAGGGACAAGAGCCGCCGCAGCTCGCGCAAGAGCAGCCG
CCGGAGCAGGAGTAGGAGTCGGAGCAGGAGCCAGGCGAGACGCAGGAGGTCCGAGTCCAAGGAGGAGCCCAAGGAGCAGAAAGATCTTAAGCTAGAAGAA
GCCGACGGACGCGCTGCCGATAGGGAAGAGAAGACGCACGCTGCTGAGGTGAAGAACGACAAGAAGGAGCAGAAGAGTGGCCAGAGTCAGGAGAAGAAGA
GACCTGCAGCTGCTGCTCCCCCTGTTGCCGTGAAGACTGGAGGAGCTACGTTGAAGAAGTTCAAGTTTAGTGGCATCTCGTTGAAGTCGGGCAACGTTCA
GGCTCCTAAGAAGAAGTCCGCGCCGTTCTTCAACGCGTTGAGCGGAGATAGCAAGCCGCCGCTTAATGGCGAGAACGCGGCGAAGAAGGAGCAGCGTGAG
AAGCAGAAGCTGCTGATCGAGGAGCAGAAGAAGGAGGAGAAGGCCAAGTTCCTGGCGGAGGAGGACGCAGTGCCCAAGCAGTTGGCTCTATGGACGCCGG
TGGATGAAGAGAAGAAGGGTGAAACTCCCGAGGAGAAGAAGAAGAGAGAGGAGCTAGAGGCGCGCCAGCGGGAGCGAGTGCAGAAGGTCGTGGAGGAAGT
GGACCCGCTGGACGCCTACATGGCCGGTCTTGTGGACGAAGCGGCTATCAACCAGTCGCGCGCGAACCCTGCTGCCAACGTGATCTCCCAGTCCGAGATC
GAAGCCAAGGGCAAGATCAATATTTATGGTACGTTCCTGCCTCCGGATGCCGCTGAGCAGTCGAGCGTGACCGCTTCAACGTCTTCGTCTACGGCTGAAC
CCAAGGCCGCAACTAGCGAGGTGCAAGAGACTCCTGAAGAACGTGAAGCGCGTGAAGAGCGCGAGCTCAAGGAGTTTATGCGAGCGATTAAGGAGAAACG
AGAGCAGGAGGAGAAGAAGGCTGCGGATGCTACTGCAGCCTCTACGACTCAAACTAACGGAGCTGGACCAGAAGATGAAGAGGACCCGATGCTGAAGAAG
GATGACACGGGACGCATCTACCAAGGATTTGAAGAAGATATTATCGGTGAAGACTCGGAACTGGTGGACCAGCGCTCAGCTCTGGAAATTCTGCAAGAAC
AGCAGAAGAAGAAGGAGATCAAACCGGTGGATCACTCGAAGATGAATTATCTCGCGTTCCAAAAGAAATTCTACGTGGTTCCGAAAGAAATCAAAGACTT
GTCGGAGGAAGAGGTGGAGGCTCAGCGTAAGGAGTCTGAAATCAAGGTACGCGGAAAGAGCTGCCCGCGCCCGCTGCAAAAGTGGACGCAATGTGGCTTC
AGCGTTCGGATGCTTCAACTTATCAAGAAGCATGGCTTCGAGGAACCGTTCGCTATCCAAAAGCAGGCACTGCCGGCGATTATGTCTGGACGTGATGTCA
TCGGCATTGCCAAGACGGGTTCAGGCAAGACGTTGGCGTTCCTTCTTCCTATGTTCCGTCACATTCTGGCTCAACCCCCACTCCAAGAGAATGAGGGACC
GATTGGTATCATCATGGCGCCCGCTCGAGAACTTGCTCAGCAAATTTACATGGAGACCCGGAAGTTTTCGAAGGGTCTAGGATTGCGCGCTACGGCTGTT
TATGGTGGATCCTCGGTCTCAGAACAGATCGCTAACCTGAAACGTGGCTCCGATATCGTGATTTGCACGCCAGGCCGCATGATCGATATTTTGTGCATGA
GTGCGGGTAAAATGGTATCGCTCCAGCGTGTTACGTACGTGGTGCTAGATGAAGCTGATCGGATGTTCGACATGGGCTTCGAGCCGCAGATTACGAAGAT
TATGATGAACATTCGGCCAGATCGACAGACATTATTGTTCTCGGCAACTTTTCCTCGCTCGGTGGAATCTCTCGCGCGTAAAGTACTGCGGAAACCAGTT
GAAATTACCGTGGGCACACGCAGCACGGCGTCAGGCGATATCACGCAATATGTTGAAGTGCGCGAAGAGGACGACAAGTTCATGCGACTCCTTCAACTCT
TGGGTCTGTGGTATGAGAAGGGAAACATTCTTGTGTTTGTAAACAAACAGCAAGCATGCGACCAGATCTTCCAGGACTTGATGAAGGCTGGATACCCTGC
GCTATCGCTGCACGGTACGTCACGACATCTTTCCAATGCTATTAAAGAGAGGCTTACATTTCATTGTGAACGTTATCCCATTGTATCCCGACAGGTGGAA
AGGATCAAGTCGATCGAGACTACACCATCGATGACTTCAAACGGAAGGTGCGGACCGTGATGGTGGCGACATCTGTCGCTGGTCGGGGTCTTGACGTGAA
GGATTTGGTTCTTGTCATCAATTACCATTGCCCGAATCACATGGAAGACTATGTCCATCGCGTGGGACGAACCGGACGAGCTGGGCGTAAGGGTACTGCT
TACACCTTCATCTCTCCAGATGTACGTTGCCCTGCTTTCGTGTTAATTCTGGGCTTTAATTGTGAGCTCTGACTGACATGCGTGCAATCGTAGGAGGAGG
AGTACTCGGTGGATCTCGTGAAGGCGCTTGAAAACGCTAAACAAACTGTCCCGCCCGAGCTGACGCAACTAGCGGAAGCATTCAAGGAGAAGGTACGGCG
CTTCTGGCTCAGTGTGGCCTAACCTTTGCCCAACTGCTAATATCTCTTTTCTTATGCTCCAGGTTAAGCGCGGTGAAGCAAGGTATCACGGCAGTGGCTT
TAAGGGCAAGGGCTTCACGTTCGATGAAACGGAGCGGAACGAGACCCAGCGCACGGCAGATCTTCAAAAACGCCAATATGAATTGGACAATGGCATTTTG
GTTGAGGTACGCTATATCATAACATTGGCTGGCTTTGCGACACTGGTACTGATATTTATTTTTTGTATCTTTGTAGGATAACGCTGCCGCCGATGATGAC
GATGCAGACGAGCCGAGCAAGGAGAACTCTGTTGCTGCGACTGACAAGCCATCATTGCCTGCCGTGGCAAAGCAGCTACCTGTCGACAGCGAAGCAATGT
CCGCCTTCATCAAAGCTCAGAAAATCATCCAGAACCTCGATCTGCAGTACAAGGGTAATGGCGACGGCTCTGGCGAGAACCACTTCGTTGAGGAGCTTGA
GATTAATGACTATCCTCAGCAGGCACGCTGGAGAGTCACTCAGAAAGAGGCAAGCGACTCGGTGGCGGAGCTCACTGGCGCAGCGGTTATTGCGAGAGGG
TCGTATATTCCTGCTGGCCGCAAGCCGAATCCATCGGAACGGAAACTTTACTTGGTACGTTGGGCATTTGTGGATGTAGTGTCTTTTATCTCCCGCTCAA
ACTAATTGATTTTTTGTTCGCGTAGGCTATCGAGGGTCCAACACAAGCTTCCGTTATCGAGGCCAGGCGGGAACTGCAACGCATCCTGGACGAAACTACG
ATGCAAGTCGGCCTGGGTGGCGACAAATACGGGAAGTACAGTTTGTAA