Transcript Name :
Physo_338912
Orientation:
(+)
Number of Exons:
1
Description :
glycoside hydrolase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-282
NN-scoreoddsWeighted Score
0.7673.2360.006
*** None ***
TypeScore
nuclear391
GO
*** None ***
*** None ***
*** None ***
Sequence
        849 bases(100 bases per row)
ATGCAGAAGGAGCATTATATCAAGCTGTTGCGCTGTATCGAGGACTGTGTCGGTCGGAAGTTGACTCCTAAGGAAGTCGTGTGTGATTTCGAGGCCGCTC
TCATCGGCGCAATACGAGCATACTTCCCCGACATCCGTATCATCGGATGTTTGTTTCATTTTAAACAAGCGTGTCGCCGAAAGCTGAAGGAGTACCAGAT
ACCAAGAGACGAAGCCAAGCTAGCAATGGCCCCAAATGTCTTTGACATTTTGACGGTGATCGACCCAAGTAAAATCGAAGTTCAAGGGATTGCGTGGGTC
AAGGCCAAGATTAAAAAAGTTTGTGAGGCGAAGCATGTGACCTACTCTCGCAGAAAGTGGCGTAAGTTTTGGGATTACTTCCGACGGACTTGGCTAGAAA
TGTTTCCGCCAACGTATTGGAACGTGTTCGGCATGCGTCGTGACATTGTTAGTAGAACGAACAACCCTCTCGAGCGCTTCCACCGGCATCTGAACGGGAA
GATCAAAGCTCCACACCCTGCCATGAGCAGCTTCGTCGACACGCTAGAAGGTATTTCTCGCGAATATGTGGCGCAGCGTGTTGCTATCCAGTCCGGACTC
GCCAGGCCACCTCAACGGAAACGTTTCCAGCTACCGCGTGCGCCGCAGTTGCCTGAGGTCGGCGACATCGTGGATTCGGAGGAAAGCGAAGACGAAGACG
AGCAGCCTACCATCGCCACGGATGACCCTGCATCCTGCTCAAGCGCGCCGGGTTCAGAGTACGACGTTGCTGAGATGGATCACGATACGGTAGACTACAG
TCCAGATAACTCATTTGACTACGACGGCGATGCATCAGCAATTGTATAA