Transcript Name :
Physo_297106
Orientation:
(-)
Number of Exons:
3
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-328
NN-scoreoddsWeighted Score
0.6641.2730.003
*** None ***
TypeScore
nuclear696
GO
*** None ***
*** None ***
*** None ***
Sequence
        1062 bases(100 bases per row)
ATGGTGGGTGCCAAGCCTTCAGACCCCGGGCAGGACGCTGTGGCCGCAGCCCAAGGAGCAGGGGTCCCCCCAAGCGTCCCTCCCCAAGCTGAGGCAGGTA
ACGCTCAGGAACAGCACCATCGACCAAGCCAAGATCAAGTCCGGCCAGCGCCGTCGGCTCCACCGCACTCTGCCCCCTCCGGAAGGCCTGCCCCTGGTGC
AGCTACGCCCCCCCAGGCTGGACGGACTTCCCATGTGCAGGAAGTCCCTGGACAGGGAACTCGGCGTCGGTGCTGAGCGCCTCGAGGCCGATCTCGGAGG
AACAAGAGCGCTCTTCGCGGATCGTAACGGGTGTTTGGAACCCTCTGCTGAAGAAGCGCTTAATTACCACTATGCTCCACGAGTGGGTTGCCCCCGATGG
TAAGATGTGGACGGACGAAGAACGTCGCTTACGTGACGTCGCTTTGGCGCCAGGCGACGTGAATCGTGGCCAAAATATTCGCGAGATGACGGCCGAGGAG
TCGCAGGCCCTCCTTCCTTACGTCCGCGGCGAGCTTGAACTTCCCCACCCGCACAACTTCGTCAAGTCGACCATATCTCCACTCCACCGGGCCATGCTCG
ACGACATCCATGAAGCGCATGTTAATGCTATCCTAACGGAACCTCCCTCAGCAAGTTAACCTGGAGCACAATGCCACTATGCCCCATGTTGAGTTGTTCA
GGGAGCTGTACAACTATTGGCCAAGAGATGATGCGCCGCCTGTAGCGCGATGTGAAGCGGTTTGTCTACGATGGGGCTCATACTTTGGGCTTTGTTTTCC
ACTCTCGCCGTGTGGCAGCTGTGTGGGAGTGCCAATTATCCGTATTCAACGGACTGTCATCACTCTGCATGATACAGTCAGGCGCAGTGAGGCTGATGCT
GGCAGTTTCACGGCTGTTCAACTCGACGGGGTGTACGCACTTCACGTGCGGCGGGGGTCAACTGCGTTTGTCGGCCCTAGCTCGAGCCTTTACGGAGCTC
AGTGGTGCGAAAGTTCTGGATGTGCAGTTTCCTCGGTCCACCAAAGCGGACATTTACCATAA