Transcript Name :
Physo_325852
Orientation:
(-)
Number of Exons:
6
Description :
myosin heavy chain
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
690-701
1-666
725-1028
667-689
702-724
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3314 bases(100 bases per row)
ATGGCTCGCCGCCACGACGTCGACGTCAACGACATCGACCTGGAGGAAGAAGAGCTTGACACCGACGACCTCGAGGCCGCTGGCTGCGCGGTTTGTGCCC
TGGGCGCGCATCGTCCTCGCCTCCCCGTCGCGACCCAAGTCCAGCTTCCGGCTTCAGGCGCCCCCGTCCACTCGGTGACTGCTCTTGTCGCCGACGCGCA
CACTCTCCAGCGCGAGAACCAGGAGCTGCGCGCCCAGTACGAACTCGTCTCAGCGCACAATGTGGGCTTGGCTACTCACGCGTCCGTGCTGCATGACCGC
AATCTCGCGATCTTGCATCGTGCTCGCGAGGATTATCGCGCAGGCATGATCCGGCTCGAGCAGGCGATCTTCTCCCGGGAGCACGCCGAGCTGGACTACG
CCGTCCTGGAGGACCGAGTGGCCGACTTCCGCGCTCGTGCTGAGCGCGCCGACGCTGCCGAGACTCTACTCCGCGCCGAGCGAGGCTCCTCGACAGAGCA
ATATCGTGATCTTCAAGCTCAGCTCCGGGCGGCACGAGACCAGGTCACTGACTTGACTGCCCAACTCGCGCGCGCTCCTGCTACGCCGCCTCCCTCCACC
GTGTCGCTAGCGCGGCTGTTTGCTGCACAAGGCGAGCGCGACGACCTTCGCATCGAGCGTGACGACCTTCGCGTCGACCTCGCAGCCGCCCAAGCCGCCC
TCGCTCCTGTCCAAGCGCGCGTGACCGCCACCGAAGCTGAATGAGATCACATGCGGCAGCTCGTGGCCACTGCCGAGCAGCAGCGCGACGCCGCTCTCGC
CGAGCGTGACCGCGTGACCCGCGTTCTCATGGCCGTCGCGTAAGAGCGTGACGGGGCCCTCGACATGCGAGATCAAGTGCGTCGCGCCTCCACGGCCGTG
AGACGCGAGCGAGACGCTGCTGTCACCGAGAGGGACCGGGCACGTCAAGCCGTGGCCGCCCTTGAGCAGCGGCGAGACGCTGCCGTCGCCGAGAGAGATC
AGGCTCGTCAGGCCTTGACCGCTCTGGAGCAGCAGCGCGCTCTTGTCGACTAAGAGCGTCGCTTTCTCAGAGCCGCATGGAGATCGAGGCGGCCCAGAAC
CTGAACGTCCCGCTGCAGGACGACCTTCGGCGCGTCAACGCGCTCTTAGTGGCCCACGCCGAGGTGCTCCGCCGCGGCGCGACGCGTATCCACGAGCTGG
AGGAGTCAGTGGCTACTGCTACGACTCTCCGGGTGGCCGCCGAGTCCGAGATGGCGCGGGCTCAAGCCGGCGAACTTTGCGCCACATCTCGCGCGGCGCA
GTATCAAGCTGGGTGGCTGTCCATGCGGCGGTCGTCTCAGCAGCGTCGAGGAGCAGTCGGCGCCCAGACCCATCGTCTCAGCGCTCGCGTCGCCGAGCTG
GAGGAGGAGCGCGACTTGGCTATCCGAGAGCGCGACGAACGCGCTGTGGCTTGGCGTCGGATGCTTCGAGACGCGCGTTGGGGCCGAGAGCTGGCGCGGC
GGGTGTGCGACGAGCTTGCTGATCGTCTCGCCGGCGTCGTAACGCGTGTAGGCGGGCAGATCGACACCGCTGACCTGGTCAGGCGACTCGAAGCCACGTT
TACGGCGGAGATCGACGCCTCCCCCTGCTATTCCTACGTCCGCAGCAGTTCCTGTGGCATCCGCGGTTCCTGTTCCTGCTCCAACTGCGTCGAGCTCTGG
TGCCCGGGCGGGCTCGTCGGCTTCGACGGTGGGCTCGACGATTGGCGCTTCCCCTCCAGCAGGTCCTTCGGGCTCCCGTCATGTTCCGACTTCGTCCTCT
GCCTCGTCCTCGTCGGGTTTTCGGCGACCTCGACACGGCGCGTCGAGTCGTTCGGGTTCTCAGTCACGCGCGTCTAGGCCGTCAGGAGTGGCGTCCGCTA
CGTCGTCTGGTTCTTCGCCCCTTCGACGTAGTCGACGGCTCTTTACCGTGGCCGACACTGAGGCCTCCGACAACGCCGCTGCGCAGGCCTCATCTGCAGC
TACGCCCTCTACGGCCGCTGCAGCGGGCGCACGAGAGGACGCGTCGCGCTTCGGCTCCGAGTCTTCGGACAGCGAGGACCAAGCGCGGCGAGCTCAGTCT
AAGCGCCGCCGGCTGCATAGCTCCGGGTCTCGCTCACGGTCGCCGGCGCGTCCGTCTCCACGTTCGCAGTCACGTTCCCGGACATCCCCGCGCTCCCGTT
CTGCTTCGCGTTCGCGTTCCCGCTCGGCCTCTCGTTCGCGTTCGCACTCGCCTCCACGCTCGCGCTCCCGTTCTCGCTCGCCCTCCTTGGCGTCGACGCG
TTCGGCCGGCTCAACGCGTTCGGCGCACGCGGCGGGGTCGGCGCACTCGGTGGGGTCGGCGGCCTCGCGCCAGTCTTCTCCTGCACGGCCGACGCACTCC
TCGTCGAGGGGCCGTGCGGCAGCCGGAGCTGGACCAGGCACTGGTCCGGGCGATTCGGGCGACTCCAGTCGTCCGCTTCCTCGTCGTCCCGCGCCTCGTC
CTCGAGCACCGCCTCCAGCGGCTCAGCGGGGAGTGCTCCGGCGGCGCCATTCTTCGACCCTGTGATTCCGCCTGCCGGAACTCCGTCTGGCTGGCGGCAG
CCTCGCTACGCTCCTTGGTCCAAGCGGGTACGACGTCTCCGCCTTCATCTCATCACCGTGCAGGAGTTGCGAACGCTCTTCCTGCCGCCGCCCGGCTGGA
TCCTTCCGCACCGTGTCCCCCCCCCCGCGCCTGCGAACTGGAACCGCGCCCTCGTGACTCTGGCCAACGTCGACGCGCTATACGCGACTCGGCCGTGGCG
CTACCTCGCTCAAGCCGCTGAGGCGCTTCTCTTCGCGTCCGGCGACGCGGCGTTCCGCCCATTCCTACGTCGGCTCCGGTACCACATCGAGCACTGGGCT
CAGGCGTACTGGGAGGCCACCCATGAGCTCTTCGTGCAGGGCGCGGAGTGGAAAAGGTGGCGCACGGCGCGCAACTCGCGTCGCTCACACGCGGGCAACC
ACCTCAACAGCCTGTTGCAGCTGGTGGCCGGGCTGTTCCAGCAAGGGCTCGCAGACATGGACCTCTTGCTGGACCCAATGGTGCTTCACTTTCCGCCCGC
GCACGCGTCGATCGGACTGTGGTATCCAGGCCTCCAGCACGCTACGTTGCAAGCCGCGCTCGACGATATCGACGCGCAGGAGCCCTGGCGCCGGGTCTAT
CGGACGCCGCTCACTGTGGCCGAGATGGACGCCTACATACGCTGCCAAGTGACGCGCGATCATCCAGCCTGCCATGTGCCGCGTCTTGCAGGTAAGTTCA
TCCAGCAGGTTTGA