Transcript Name :
Physo_468899
Orientation:
(-)
Number of Exons:
2
Description :
PREDICTED: uncharacterized protein LOC101767957 isoform X1
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, SWIM-type8.506PS50966
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-184
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        1373 bases(100 bases per row)
ATGCTTCCCGCCCACGATGGATCAGCGGCTTCTATGTCAGGGGCCGCTATCAGGAATTTTCTGAAATCGAAAGGAGCGGACGTAAGCGCTACATCGGTGT
CCAGAATGAAGCAGAAAATTGACGACAAAATTCACGGCGACTTGGTAGAAAGTTACCAAAACCTGCGGGCGTACTTCGAGTTGATGGCGCACAAGAACCC
CGGATCGGTTTGGAGAGTGGAAACTGCCGCGGACGGATCGTCGTTTGGTCGAGCGTGCTTCATCCCTAACGCTGGTATTCACATTGCCCAGAACTGCAAA
AAGATGGTCGGCTTTGACGGGGTCCACCTTAAAGAGGAAATGCACGAACAGGGCATTTATCTGGTAGCTACCGTGAAAGATTACAACAACCACATCGTTC
CAGTTGGACTCGCGCTGGTTTCACAAGAGGACAAGGCCAATTGGATTTGGTTCCTGGGAGCATTCAAGGAGGCAGTTGACTGGGAAAAGTTCACGATATT
GTCGGATAGACAAAAAGGTCTGCTTCCAGCTGTCGCGACAATTTTCCCAAACGCTGGCCATCGATACTGCCTGCGGCATATCATGGACAACATTAACAGG
AAATGTTTCAGGTTGTCCCAGGAAGATCGTGCGTGGGTATGCCGAATGGCACGCAGCGACTGTGAAAATGACTATAAGCTGTATCGAAGTGAACTCGCCG
TGAACAACCCTGCCGCTGCGAATTTTCTGGACAGAATCGAACTGCTCACTGGGTGAAGTACAGTTTCCAAGAAAAGTTTAATCTCCCGACTTTCGACGAA
ATAACCTCAAATTTGTCAGAGCAAGCGAACAACTGGATGGGTAAAGAGCTTCGGACCGCCAAACCCTTGGACGGATTCCACTTGTACTTCTTGAAGCTGA
GTCAACTGATGTCCAAAAGGCGACAATTGATTGTAACGTGGACAAAATCTGGCGCACTCTCGGATTTAGTCCCCAAGTTGTTAGAGCGACATACAGACCG
CCAAGCTGCAGCTGATATGTGCGAGTTTACACCCTTTCTCGGGGGTGCGTACAGCGTCTTGTTCAAGGGCCCTGTTGCCATACCAGGATATGTGCACCCA
GACCGGGTAGTGGATTTGCCAGCGCAGGAGTGCACGTGCGGCTATTGGCAAGACCAAATGTTCCCTTGTGTCCACGCAATTTGCGCTGCTTCAAAGGATT
GCCGACGAATCGAAGACTTTTATGACGCCAAGCGTATGTCGATCGAGCACTTCCGCGATACGTACACATTCAAATTTCTCCCTTGGCCGACAACAGCAAC
CTTACAGCGGGACGACACAATTCTTCCTCCACAACTTGAACCACTCCTGAACGGATTGGTAAAAGAGGGTTGA