Transcript Name :
Physo_476965
Orientation:
(-)
Number of Exons:
2
Description :
PREDICTED: sentrin-specific protease 2 isoform 1
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Peptidase C48, SUMO/Sentrin/Ubl114.143PS50600
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-204
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
cysteine-type peptidase activityGO:0008234IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        735 bases(100 bases per row)
ATGACACCTTGCTATAGACCCGACAAGGAGCAGCACAGGCTTCAAGTTATTGAAAGCGACCTGAAAACACTCGAACCCAAAGTGTGGCTGAATGACACTG
TCATCTCCTACTTTATTCGTGAGTTTATCGAGGCTCACAAGTCTACCTACAACTTCGATGGTCAGTTTTTCGGGACCATTCTCATGAATTACAAGGCGAA
CAAGCGAAACATGGGGAAACCCTACGTGGCGTCCTGTGGGATTACTGCGAATTTCCCCTACGAGACGTACCCGACAATCTTGGTACCTGTGTGCATGGAC
GTCCATTGGAGTTTCGTCGTGACTCAGAACCCCGTTCTCAAGATTAAGGATCTGGCGCTGGTTATACTGCATGTTGATTCCATGCAGTATCACAACACTG
ACCGAATCCACCGAATTCTGGGTGGATACTTCCGTAAGGAAGCATTGGAAAAGTTCCAGGTAAAGAAGATCACATACAAGGTTAAAGCCCACAAGACCAA
GCCACACCAGGACAACACATACGACTGTGGCATCTTTATGCTATACTTCATGCGCGAAGTCAACAGAGCGATCATGCGTGCAAAAGGTAACATCATTCTA
CCGCTATCCATTGCTAACATTTGTGCGCTCCCAAAACAAACCCGGGACCACTTCAACTGCGATTTGGAGCGAATGGAGTTCTTCAGGCTCTTCCGCAACG
ACCAAGCAGTGCAGTCAGAGATAGCTAATCGCTAA