Transcript Name :
Physo_309970
Orientation:
(-)
Number of Exons:
1
Description :
tRNA pseudouridine synthase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-497
NN-scoreoddsWeighted Score
0.5791.7930.004
*** None ***
TypeScore
mitochondrial478
GO
*** None ***
*** None ***
Cluster Id
4848
Sequence
        1494 bases(100 bases per row)
ATGGCCGGCAAGCGCAAGAAGACCCACTGGGCCGCGCGCCGCAAGACCAAGCAGGCGCGCCGCGACGGCCAGCCGGATGACGCAGAGCCGCGTCCGGACC
GCCGCGCCGAGCGCTCAGACGCCGTCCACCCCGGCTCCTACGCGGCGCAGCGCCAGCGCCAGCACCCGACGGACGCAGCGGACAAGCCCGCGCTGTCGCT
GCCGACCAAGCGCCGCTACGGCCTGTGGGTGGCCTTCTGCGGCAAGAACTACAGCGGCATGCAGATGAACGAGGGCGTCAAGACCATCGAGGCGGAGCTC
GAGCGCGCGCTGTTCGAGGCCGGCGGCATCGCCGAGAGCAACTACGGCTTCCTACAGAAGATCGGCTGGAGCCGCGCGGCCCGCACGGACAAGGGCGTGC
ACGCGGCGGGCCAGCTGCTGACCGCCAAGCTGCACGTGGGCGAAGACGCCGACATCCCGGCCTTCGTCGGCAAGGTGAACGCCGCGCTGCCCGAGGATAT
CCGCGTGATGCACATGGTCACGGTCACCAAGAACTTCAACGCCAAGATGACGTGCGACCAGCGCACCTACGAGTACCTGGCGCCCACCTTCATCTTCGCC
AAGCGAGCGCGTGCTGCAGCCATAAAGGAGTCGGAGAAGACGGAGGAGAAGGGAGATGCAGCGACTGCGCAATGGCCGTCGGACCTGCGTGACTCCGAGG
AGGGCTTTGACGACAACGTGGTGATTGATAACACGACGCTAGAGGCGCACAAGGCCTTCCGACTAAGCGACGAAACGCTGGAGAAGCTGAACGCCACGCT
GAAGGAGTACGTGGGGACCCACAACTTCCACAACTTCACGTCCAAGATGGAGCCGACCAACCCTCAGGCGAAGCGCTTCATTATTTCATTTGAGGCCGAA
CGTCCGTTTGTGCAGAACGACATGGAGTGGGTGCGGCTGCGTGTGGTCGGCCAGAGCTTCCTGCTGCACCACATCCGCAAGATGATCGGCACCGCTGTGG
AAATTGTGTCGGGTGTTACGGACCCCTCGACAATCGAGCGCGCCATGCAGCTGACCAAGATGGACTTGCCCAAGGCGCCTAGTGTGGGCTTGTACTTGGC
GCAAGCGCACTTCGAGGTGTACAACTTGAAGATGGCCGAGTCTATTCAAACGTCCCACCCGCCGCTGGACCTGAAGGAGCCTGCAGTCGCCGCTGCTGTG
GAACTATTCAAGCGCGATTTCATCTTTGACCACATTATGAAGCACGAAGAGCGCACTCGGACGTATGCGAAGTGGCTACGCACCATGGAGGTGTTGCCGT
TCGACTACGTGGCTAAGCCCTATTTGGAGTGGAAAAAAGAGAAGGAGGAGGAAGCCGAGCGTACCGACCGTGCTGGTAGGCGGGAGTTGGCCAAGGCAGC
GCGAGCTGAAGTCGCTGCCCAGGCCAACAATCCGTCAGAGGTACCAGCCACAAAGGAAGTTGCCAAGACGGAGGAGGAATCTACCGCTAGCTGA