Transcript Name :
Physo_479170
Orientation:
(+)
Number of Exons:
1
Description :
eukaryotic translation initiation factor 5B
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Elongation factor, GTP-binding domain1.1PR00315
Elongation factor, GTP-binding domain1.1PR00315
Elongation factor, GTP-binding domain1.1PR00315
Elongation factor, GTP-binding domain1.1PR00315
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-620
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
GTPase activityGO:0003924IEA
*** None ***
Cluster Id
4041
Sequence
        1863 bases(100 bases per row)
ATGGAGGCGGAGCGCAAGAAGAAGGAGGCGGCTGAGCGTCGTCGCGAGCGTGAGGCTGCTGCGCGCGCCAACGTGTCCCTGGACAACCTCCGTTCACCTA
TTTGCTGTATCATGGGTCACGTCGATACCGGTAAGACCAAGCTGCTTGACAACATCCGTAAGACCAAGGTGCAGGACGCGGAGGCTGGTGGTATTACCCA
GCAGATCGGTGCGACCTTCTTCCCCGTGGAGGCCATCAAGCAGAAGACCGCTCGCCTCGCCGAGACGATGAAGCTCGAGTACCGCCTGCCCGGTCTGCTT
GTGATTGATACCCCTGGTCACGAGTCTTTCACGAACCTGCGTACGCGTGGTTCGTCGCTGTGTGATATCGCCATTCTGGTGGTTGATATCATGCACGGTC
TGGAGCCGCAGACGTTGGAGTCGCTGCGCCTGCTGCGCCAGAAGAAAGCTCCGTTCGTGGTTGCTCTTAACAAGATCGATCGTTGCTACGGATGGAAGAC
GATGCCCGACATGCCCGTCCAGGAGGCGCTCAAGCACCAGAACGAGCACGTCATTCGCGAGTTTGAGGACCGCATGAAGTCCATTATTGTTGAGTTTGCC
GAGCAGAAGCTGAACGCCGAGGTCTACTGGCGCAACAAGGACCTGGCGCACACGGTCTCGCTTATTCCCACCAGTGCTATCTCGGGTGAGGGTGTGCCGG
ATCTGCTCATGATGCTGACGCGTTTGACGCAGGAGCGCATGGCCAAGTCGCTGGCTTTCGTGGATATTCTGCAGTGTACCGTGCTTGAGGTGAAGGTTAT
CGAGGGTCTCGGTACCACAATTGATACGATCCTGGTGAATGGTACACTTGAGGAAGGCTCGACTATTGTCGTGTGTACATTAGATGGACCTGTGGTGACC
ACGATTCGGTCCCTGCTGACCCCGCACCCCATGAAGGAAATCCGCGTGAAGGGCGAGTACCTCCACCACCAGAAGATGAAGGCCGCTATGGGTGTCAAGA
TTTGCGCTCAGGGTCTCGAAAAGGCGGTTGCTGGTACGCAGATTTACGTGGTTGGCCCCGATGACGACGTCGAGGAGCTGAAGGACTCGGTCATGTCCGA
CCTTACGGGCATCTTGGACTCAGTGAAAGCCACCCGCCGCGGTGTCATGGTGCAGGCTTCGACTCTTGGTGCGCTGGAGGCGCTTCTGGAGTTCTTGCGT
ACGTGTGACCCGCCTATTCCCGTCTCGTGCGTGAACATCGGACCCGTGCACAAGAAGGACGTTATGCGTGCCTCGGTGCAGCTCGAGCACCAGCCCGAGT
TCGCTACCATTCTGGCGTTCGACGTGAAGGTTCACAGCGACGCCACGGAGCTGGCCGCGGACCTTGGCGTGCGCATTTTCACAGCTGACATCATTTACCA
CCTGTTCGACCAGTTCACGGCGTACATGGACAACTTCCGTCAGGCACGTCGCGAGGAGTTCGCAGAGGTTGCTGTGTTCCCGTGCGTGCTGAAGATCCTG
CCCAACTGCGTGTTCAATAAGAAGGACCCGATTATTCTCGGCGTGGACGTTGAAGAGGGCATCCTGAAGGTGGGTACGCCGCTCGTGGTGCCGTCTGCTG
GCGGCTTCCTGGTGGGTAAGGTGGGCTCGATTGAACGTGAGCACAAGGAGGTGGACCGCGCCAAGAAGGGCGCGTCCGTGGCCGTGCGGATAGACAACGA
GGGCAGCGTCATGTACGGCCGCCACTTCGACCACAAGAACAAGCTCGTGTCGCGCCTGACCCGCCAGAGCATCGACGCGTTGAAGGAGAATTTCAGGGAA
GACCTGCAGAAGGAGGACTGGCAGCTCGTCATCAAGCTCAAGAAGGTGTTCGATATCATTTAG