Transcript Name :
Physo_553492
Orientation:
(+)
Number of Exons:
2
Description :
mitogen-activated protein kinase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain45.304PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain1.3SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-857
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        2628 bases(100 bases per row)
ATGACGACGCCCGCGCGCTCCCCGCTCTCGGCGCCGTCGTCGCTGCTGCGCCGCGTGGCGTCCCCCGTGCCCGCGGGCCCGGGCAGCGGCGGCGGCGCGC
GCTCGCAGACGCTGCTGTCGCGCCTGTTCCGGCGCAAGGACCGGTCACCCGCGGCGCCGCGGCCGCTGAGCCGCTCGCTGTACGGCGAGGAGGAGGAGAC
CAAGACGCACGTGGACTCGCCCATGCGCGCGCTGCTGCGCTCGCTCAGCCTGCAGCGCAAGAGCCGGCCGCAGGAGGTGCGCACGCCGCCCGCCGACGCC
GCGCAGGTGCTGCTGGAGGGCGTGCTCACGGAGCTGGCGCAGACGCGCTACTGGCGCTCCAAGCCCTGCTACTTCGTGCTGGAGCAGGCGCTGGTCGGTG
CCGGTGCCGGTGACACGCTCGGCAGCCAGTTCACGTTCACGCTCCGGCAGTTCCACTTCCTGCCGGAGACCAGAAGGCCCGGCCGCCTCGTGGCCATCGC
CACGCTGTCCCCGGACGACGTGGTCTCGGACCTGCGCACGCACCGACAGGTCAAGCACGCGCTGGAGCTGCAGCTGGCGGCGGCGCATCAGCGCGTGGAG
ATCGCAGGGGCCCGGGACGCAGACGACGACACCAGGGAAGAGAGCGCGTCGCAGCTGCTGCGACTCGCGGCGACCGACGAGCGGACGCTCGTCAAGTGGC
TGCAGATGCTCAACTCGTGCATCAGCAGGCTCGTGCTCCAGGCCGAGGAGCGGCAGTACCGACACGGAGACGCCGCCGGCTGGAACCCCGTGACGGAGCC
AGCGGCCAAGATCGTGCCCATGTTCGGAGATGAAGGCCGGCGGTCCAGTATGCTGGTGATGACGAGGGACCGCGACCACAACCTGAGCGCCATCAGCTTC
ACCAGCAGCGAGTGCAGCAACAACAATCACTACGAGGAGGATATTCCAGCGGAGGAGATTCGTGCGGCGAGGAAAGATGCCGTTGGGGAGGAAGACGAGG
ACGAAACGAAACCGCCCGCGGATGAACGATACGACAGAGTCACCCCAGCTTTGGAGGATGAAGAACTGCCGGCGAGGAGGGCGATCGAGTATTGCTGCAC
GCCCGAGTATCGATCAAGTGGGAGTGGATCATCGAACTCACAGAATTTAGTGGATACGGACAATAACAACGCCGCGGACGAAAAGGAAGGCAACAACCAG
GAGGACAACCAGGGCGATGACGACTCGGAAGAAGACTCTCTTGCTGGAGATCTCGCCACTCAAAGTTCGGTGGCACCATACAAAAGTGCAGTTTTGGCAG
GCAGGGGCGTTGCTGCTTACCAAAGCGTGGGGCTGGAGGACGAGTACACGAAAGCTGGCTCAAGATCGGCAGTAGCAAACGGACGCGGCCGTCTCCCTCG
TGCTGCCTTTGGCGCCACAACTAGCAGCTCCGGTTTATTCCCGACGCTGCGGCCACAGACACACTCGTTCAATGCGAACGGACAGGTTTTCACTCTGGAT
ACTCGCTACCAGCTAGTTAAACCCATTGGCAACGGAGCGTACGGTGCAGTTATCGCAGTCAAGGACGTAGTGAACGGTGGGGAGAACCTGGCCGTAAAGA
AGATCACCAACATCTTCGAGGACCTGGTGGATGCTAAACGTATTTTGCGCGAGGTGCGGCTGCTGGGCCACTTCAACCACAAGAACATCACGCGGCTGCT
GGATCTGTCGCCCCCTCCTTCTCGCAAGCAGTTTGATGACATGTACATCATCACCGAGCTCATGGAGACCGACCTGCACCAGGTGATCTACTCGATGCAG
CCCATGTCGGACGACCACGTCAAGTACTTTTTGTACCAAATGCTGTGCGCGCTGCACCACATCCACTCGGCCGGCGTGCTGCACCGTGACATGAAGCCCA
GCAACATTTTGTTGAACGCGAACTGCGACCTTAAGGTGTGCGACTTCGGCCTCGCTCGTGGAGGGGTCGGCGGACAAGAGGAGCTGCTGCAGCCTGGTGA
ACTAACGGAGTACGTGGTCACGCGGTGGTACCGCGCGCCAGAGATCATGTTGAACTGTCTGCACTACACTACAGCTATCGACGTGTGGGCGGTGGGTTGC
ATCTTCGCAGAAATGCTGTTGCGCGAGCCGCTGTTCCCCGGAAACGACTATTTGCACCAGCTTAAGCTCATCATCAAGTTCCTGGGCACGCCAAAGCAGG
AGGACATTGGGTTTGTGAAGAACACCAAGGCGATGCGCTTCCTCACGAAGCTCGCGATCTCCAAGCCGAAAAAGTGGCGCGACGTGTTCGCCGGCAGCGG
CACGGAGAACGCCGTGAGCTCGGAGGCGATCGATCTACTGAGCAAGATGCTGTTCTTCAACCCGGAGAAGCGTATTTCAGTGGACGCGGCGCTGCGCCAC
CCGTACCTGGCCACTTTCTTCGACGAAAACGACCTCGTGGTGTCGACTGCGTTCGACTTCTCGTTCGACCTGCCCGACGATCAGCTGTCCAAGGACGCGC
TGATCAACTTGCTGTGCGAAGACATCGAGCAGTTCCACCCACCCGTGCCGACGTCTGTCACTCCGATGCCATTGAGCGCCGCCGCCAGTCGATTCTTCCG
GATGGGGATGACGGCGTCGGCCAGCTAA