Transcript Name :
Physo_468426
Orientation:
(-)
Number of Exons:
5
Description :
JmjN/JmjC protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
JmjC domain23.603PS51184
HmmSmart predictionP-Valprediction_id
JmjC domain1SM00558
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-395
NN-scoreoddsWeighted Score
0.6091.9980.004
*** None ***
TypeScore
cytoplasmic522
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
3863
Sequence
        1464 bases(100 bases per row)
ATGGGCAGGGGGGACCCAGTCTGCCTACGAGGCCTCTCGGCTCAATGCGTGGCCCCCGCGCAACTGCCAAACTTCACGCCTGGCTCCGTCCACTCACTCG
ATTCCTTTGCGACGCATCGAGACACTGGTAAGAGCACTGTTTGGTATACTTGGGTGTTTAATGTTCTCACAGCGTGTGCGTTAGTGGTTGATATTGCTTG
CAAAGAGCGATCGAGTGGCTGCTACCATGGCAACGAGAAGGCAAGACAAAGCGTCCAACTCAAGTTTGGCGACTTCATTGACTATTACCAAGCAGCGTTC
AGGAACGAGTCACATTGGTTGCAAGAGGTTGACGACCTAGAGTTTTATCTGGCGCAATGCCCCATCGCAGTGCTCAAAGCTGATGCCACCTGCACGAAGG
CAAGTCTGCCGGCCATCATGAACGATTTCCGTCTGTAAGTCTGTAAGGTGCTTGCACGTGTGGTCCTATCCGCTACTTCTGAAACTCACGACTTTCTTGT
ACGACTTTATAGACCCCAGTGTATTGAAGACAAACCGATTTCACAAGTGAACTTGTGGATGACCGTTCAACCGGGTCGAACTACACTGCACTACGACGCG
TACCAGAACATTTTGGTCGTCTTGTACGGCAAGAAAACTGTCACGCTTTTTCCTCCATCGGACGCTGCAAAGTTGTACCCCTTTCCGGTGCACACAAAGT
CGGCGAATCACAGTCAAGTGAACATTGTGGAACCCGATCTCAAAGCTCACCCACGATTTCGTGAGGCGACGGTCCATCAATTCGAAGTCACAACAGGAGG
TGAGTTGGTTGAACTCTTTTCTTACCAAAGAGCTCGATAACTCGTCGACAGTTTAACAAGCTGGAAATGTCTAAACCTTTTATGATCTCCTGTAGACGCA
ATTGTGATTCCAGAGGGCTGGTGGCACCAGGTGGACTCGGATGCGTTCACTATTGCTGTCAACTATTGGTGGGATGGTGAGCGCGAAAAGCTTGTAGCAG
ATAAACGCATGGTACCGTATTACGCCCGGGTCATGTTGGAGGAACTAGTTAAGCAGGAGTGCGACTCGCAGCTACATGCCCTGCGATCGTCGCCACAAGC
CGGCGATCCCAGCATTCCCGCGGACGAAATCAGCGCAGCAGCAGCAATTATTGCGGAGGAAGCTCAATTTGCGCGCGAGAAAGTGTTTTTATCGTTGGAT
GATGATATTTTCACGAAGACGCAGCGAATTTTGGCAAGAAGGCACGCTGCGGACTGGAAAGATCTTCTGGCAAATGCTAGCGTGGAATTGGTGGCAGTCT
TAACCAATTGCTGGGAGGGTGATAACCTAGAGTGTGATCTGCTGGAAGTGCTGTTTGACGCTCTCGGTGACGACGGCGAGATCATCAAGGAACAATTTCT
GACGAAACAGATGAAGTTCCGCCAAGACTGCGCAGCCAAAATGTATCGGTCATTCTTCTGCTAA