Transcript Name :
Physo_370092
Orientation:
(+)
Number of Exons:
1
Description :
retrotransposon protein, putative, Ty1-copia subclass
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-388
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1164 bases(100 bases per row)
ATGATCCCTACGCAAGCCTCGCCCGCCAAAGACCGCGACTTTCCTCGCCTGAACGGCAATAATTTCATCATCTGGAAGACCCGTGTCGCCGCAGCTCTCG
ACGGCAAGAACCTCCTCGGCTTCGTCACTCAAGCAGACTACGCTGGGGACTCGGACGTCGACCTCGGCGATGACGAAGAGCTCAACCCGGCCTGCCATCC
GGACATCCACGGTGTGGCCAAGCCCGACTCGCCGCAAGACTCCTCGTCAAGTGAGGCTTCTGATGGCAGCTCGGATGATTCCGCCGGAGACGACGGCGAT
GTGGACATGGAGAAGGAAATACCTCCCGTGGTCCTGTCCTTCACTGCCCAGAAGAAGCAGGAGTTGGACCATGCTGAGAAGCTGAAGGCCAAGAGCCGAC
AGCTGAGCGCCAAGAAGCTACGCCACATGGAAGCGAAAGCCAAGGCGTTCCTGATCAATACCATTGACGACCAACACGTCCTCATGGTCAAGGAAAAGAC
TAAAGCGTATGAGATCTATCATACTCTCTGTAGCAAGTACGAGGATGCAGCCATCCACGGCGACCCGTACTTTATCCAGTCGTACCTGATGGCACTGAAG
TACAAGGAAGGAAGCGACCAGGTCCAGAACGAACTTGCGCGCAATCGCTACGTTCTCAAGCAGGGGACCCCAGAATCCCAGGAGACCCGTGCTAAAACAG
CCATGCCAGCCTCAGCACCTGAGCAAGTGCTCGTGGCGGCTCCACCCAAGGAGGATACAGCGCTGGCGGCATCGCTCAAGTGCACCTACTGCCATCGTGA
CAACCACGACACAGTGGAGTGCTTTGTGCTGCAACGCCACCCCCACAACGGACATGTCAAGGCCGGCACAGTACTACCAGCCAATTTCAAGCTGAAGCCA
CTCCAGGAACCGCGGTCACAACAACAGCAACACCAGCGACAGCAACAAACGTCGCAGCGCCACCACCCCTACAAGGGCAACTACAATGGCAACAGCGGAA
ACCAGTCTCGCAATAACAACCGCGGGCCGCGCAATGGAAACCGCAACGACAATAGCAGGTCCCAAGGACGGAACAAGTACCATGGCCGCCGCAACCGTGA
TGATGAGGACAACAGCGACTACGGCATCATCGCCATCACGACACTGGACCTCAGCCAAGACACC