Transcript Name :
Physo_476215
Orientation:
(+)
Number of Exons:
2
Description :
Voltage-gated Ion Channel (VIC) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Cyclic nucleotide-binding domain19.236PS50042
Cyclic nucleotide-binding domain13.105PS50042
Cyclic nucleotide-binding domain17.121PS50042
Cyclic nucleotide-binding domain12.795PS50042
HmmSmart predictionP-Valprediction_id
Cyclic nucleotide-binding domain9.2SM00100
Cyclic nucleotide-binding domain1.8SM00100
Cyclic nucleotide-binding domain5.1SM00100
Cyclic nucleotide-binding domain0.072SM00100
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Cyclic nucleotide-binding domainIPR000595
*** None ***
InsideOutsideTMhelix
1-65
117-246
297-572
628-708
827-1130
1191-1209
1739-1857
1923-1933
85-93
265-273
596-604
732-807
1154-1167
1233-1715
1881-1904
1957-2312
66-84
94-116
247-264
274-296
573-595
605-627
709-731
808-826
1131-1153
1168-1190
1210-1232
1716-1738
1858-1880
1905-1922
1934-1956
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        7416 bases(100 bases per row)
ATGCGCGTGGTGCCGGCTCCGTCGATCTCATGGCCGTCCAGTCGCAGTCGCCGGCGGTCTTCGGTATCCCGGGTGCCAAGCAAAATGGCAATGCTGCTAC
GCCAGCGTGGCCGCACGGGCTCTTCCGAGTTCCTCATGTCCGAGAATCACAACGCGTTCGACCCCAGCTCCCGGTTTATCCGGACATGTCAGCAGATCCG
ACTCGCAGCAATTCTCTTCGAGCTCGCAGCCATCCCGTTCCTAGCAGCATTTCACCCCAAAGCCACGCGGTCGCAACTTGCCGTCGTGTACGTGTGTGAA
CTTCTATTTTGTGCAGATATCTACGTGCAACTCAACACAGGCTACTACGAGAATGGCAATGTATTACGCGACGCCCGAAAGGCGCGACGAAAGTATCTCT
CGTCACCAGCGTTCCTGGCAGATTTACTTGCACTGGCCCCACTTTCTGTGGTATTACCTAGCAGCACGACCGGATCGCGCTCGATAGCGCTGCTGGAGAT
GCACAAACTTGTGCGGGTGTGGCGTCTACCCGCCCTCGCTTCGAATCTTGATGACCTGTACGCAAGGCATTTTGCCGCGCTCAAGCTTACCAAGGTACTC
GGGTTTACGCTGCTGTTGACGCACTTCGTAGCTTGTGGACGTTTTAGCTTTGGCTACGATCACCCAGCGCCAGGCGGGGAAACGAATCACTGGCTACCTC
ACGCCCCGCAAGACGGACACCACACTGCACGAAGACAGTATCTGATGTCGCTGTTTTGGGCGTTTGGACTTCTCACGGGAGGCTTCGAGGGCGAGCTTCC
TCGCTACAACGCTGAGTTCGCTTTCACGATTGTGGTCGGGCTTTGTGGGTTTACACTGTTCACGGCACTATGCGCAACGTTCTTCCTGCTATCCAAGTGC
GAAGATGGCGACGCAGAGCTGGCCGAGGCGCGCGTGCACCAGTTTCAGCACATTTTGGCCTTCCATCGGGTCCCCATTCAACTGCAGGCACAAGCTGTGG
ACTACCTTCAGAGATATCACACACAAGCTGAAGCTAATGACCGAGAAGCTGCGCGCCGCCTTTGTCCTTCAATCTCGGTGGATATCCAAGTCGAGCTTCT
CGAAGCCACTGTCGCCTTGGTGCCGGTGTTTGCCGGGTGTGACTCCATCTTCATTCGTGCTGTGACCCGATTACTTGAGCTGATTGCACTGCCGGCACGG
GTTGCGCTCTTTCGCGCTGGAGATCACGGAAATGCCATGTACATTGTTCACACAGGCGTGTTACACACCGTTGTCGGTGGGGTGAAAGTGCGCGAGCTGC
GCAAAGGATCCTTCGTGGGTGAGGTTGCTGTGTTCGCTCGACAACCGCGCACTGCTACAGTCATCACGGCTACGTATTGTACGCTGTATCGACTTTCACG
TGCCGACGCCGACAAACTTCTCGAGGGATACCCGCAATACGCCAAAGTAATTAACCACACCGTCGCCGAGATGCTTCACAAAAGCAGCACTGTGGAGATG
CCGCCACCTCCCGCTGATAATGCACAAGGCGAACAAGAACCAAAGCCAAAGTTGGTTCTGTCATTTGTCCAGCTCGTTCGACTCAAACAACTTCTCCATG
CACGCGCTCATGCGAGGAAAGGTAGTAGGCGAAAGGTGTTGGATGACCCCACGAAAGCTGATGATCTCACGAAGACCCCAACCCAAGACGTTGCAGAAGA
TAACTCTCTGCAACCTCAAGATGCTATGCCAACGACTGTCATCACCCCCCGACCTCCTTTTCAACCACTTCTTGGAGCCCGCACCACTCCTGAAAGCTCG
ATGGCGCCTCGGCGCTCCTTACCAGTGCCGCCACATCGTAAGACTTCGCACAACGACAGTTTTCACAGTGACAGCGTGCTATCGTCACGGAAACTACTGA
AAGGCGTGACTTCCATCAAGATCTTCCCCATTATCCCCCAAGGCAAGGCAGGACTTGGTACAGCTACGACAGAACAGGCGCCCGCGGGGAACCGACGGAC
GTCATTTCTTGCCTCCGGAATAAACAGATTGACCATGTTTCGCGACAACTTTTTCCATGACAACGAGGTGAAGCCAGCCGATGCCATCCATGGTTACTAT
GAACAGTTTGCTCATCTCGCGGGATCTTCAGCACCACGTCGTCGCTGGTGGCATCGTTTCCTCATGGGCCGTGGTGTAGATGCCGAGTCGAGTTGGAGAA
TGTTATGGATTGCTGTCGTTGCTGCCGTGACTTGTTACAACTGGGTGATGATTCCTTTGCTTCTGTCATTTTCCGCCTTGGACGACTTGTGGACGAGCTG
GTTCCTTATCGCGCTAAATATTGTGACAGATTTCGTGCTCTGGGTCAACATCTACGGAAGTTTGCACTTGTCCTTCTCCGTCAACTCTGAGAAGATCTTG
GAGCCCACGCGGACAGCTGAACGATATCTGTCAAGCGGGAGATTCTTCCTCGATTTATGCTGCTCGTGGCCCTACTGGATCTTTGTACCAGCGAAGTTCA
CACACCCAGCGCTTCGGCTGCCTAGACTAATTGGAGGCTATCGATTGCGTGGATATGCTAGCGAGGTGGAAGCGTACTTCCGGCTAACTAGTCGTCACAA
GCTCATGATGCTCGGGGTTTTGTTCTTGATGCTGTACCATATCGTTGCCTGTTTGTACTTTAGCACGACGTATCTCGACAGCTTCAGCACAGGCGAGAAC
CAGTGGTTGCCATCGGAAGACGTGTACATTGAGCGACTAAATACTACCCACTTCGTAACGATCTCTGGCATTGCCCTTGCTTCCGACAGTACTCGAGTTC
AAGAAATACGAGCAGAGCAATATTTTCGATCACTGTATTATGCTGCAAACGTGCTGGCTGCGGTCGGGCGAATGGTCGAGCCTGCCAGCGATACAGAATA
TGGAGCCGCATTGATCTTTATGCTGAGTGGGTTTTTCATCACCGCTATTGTCGTGGATCATGTTCAAAAAGGTTTTACGGCGTCAGCGCTGGAGCAAAAA
GAGTTTTTCGCGGCGCGCGCGCGCTTCCAGCGCTTTCTCAAGCGCCAGAACGCCCCGCTTTCTATTCATTTACGCGTGAATTCTTTCTTGGACTTCTGGT
GGTCTGCTCATCGCGGTGCTATCATTGATGAACTGCTCGAGGATCTCCCAGGCGCCATCAAACGCGATGTTGTGCGCAGCATTTGCACACCAGCGATGGA
CTCGTTGGAAATGCTGTGCAGCAATACGACCAGCCCTGAGAGCGATGGTGCTACTACACCGATGCAGGAGTCGGCAGGACCGACAGTCCTCGAGCAGCTG
GAAGAAATTTTCCTGGATAATATCAAGTTTGTGCTTTATGGGCAGGGAGAGATCATCTACCGTCGCGGGGACTACGCCAGCGGACTCTTTTTCCTGCTGG
AAGGCAAGGTGTCCATAACGCTGGATGGGGAAGTCCCTCGGCATGTCCCGCTTGGTGGCTTTTTCGGGACGGCAGCACTTCAATCGACTGGTGCTCGCGA
CAGACGTGAAAGTCGACGGCGCTCAAGTGTAAGGTCGACTACCGGTGTGGGGTATGCAGAGCGTGTGACTGCCGTTAGCGGCTGCATCGTGGTGTATATA
TCGCGTGAACATCTACACGCGATGCACTGCGTGTTGCCGACATTACCCGAATGTTTGCGCAAGTTGGAGCAACGACTTCACGACTCGCGCGTTGCACGCT
CGGCGGATCTGAGGGCATTCCAGCCGCGAGTCGCGCTTGGTTTGAACAACCCAACCATGCGCCGAGCACTTCGACGCAAACAATTGACGGGCTTTGTGGA
GTTGCTGGCGAAGAATCTGGAGTGGTGGCAGCGAGGCACAGCTGTAGACCCGGACTGGCCGTTCGTGGGGATATGGGAGGCCACAATGCTAATGGCGTCA
ACTCTACAAGGAACGTTGGTCATGTTTTACATTTGCTTCGGGGTGAATGAGACCACGCACGGTCGCGCCTTTGCCGATGGAGTAATGATCGCGCTTGAGC
TGCTATTCGTCCTGGATGCGTATCTCCACCTGCGCTTGGGGTTCTATGAATACGGTAACAAGGTGATGGATCTCGTCGTGATTCAGCGCCGCTACTTGCG
CTCGGTCTACTTCGCTATCGATATGGCTGCTCTCGTCCCGTTGTTTATCCTCAACTGGACTCTAACATCAACGCGTTTGGAGGTACTCAACATCAACAAG
ATGCTCCGATACTTCAAGGGCTCAAGCCAGTTCCGTACACTGGAGACGAAGTACGTGAAGCTCACGACGGAGCTTCGGCTCCTCAAGCTCGTCTACTATT
CCTTTCTCGCCTCGCACATGTTCGGGTGTATCTGGTTTGATTTCGCAGCCCACAAGTCTGGAGTTCATATTGTTATGAGCGGTGGAGACGATTGGTCGCC
AAGCTTCGGAGCTACACTGTGGGGCCCTTACAAGTCATTGGAGTCAGGCGCGCGTGGGCTCCAATACCTAGCATCCACTTTTTGGGCCTATGGTTTGATG
TCCAATTCGAGCCAAGGTGAGCTGCCGAAGACGGTGGGGGAGTGCATCTTCAGTGTGATCGTGATGACGACGGGGTTCTTCCTCTTCGCATACGTCGTTG
GTCACATCTCCGACGTGATTGAGCTGCAAGACTCGGAGAACCGCCATTTCGTGGCCAAGTTGAGTTCTTTACGCCAGCTCCTGCGCCACTTTGACTTGCC
ACCGCGCGTTGAAGAGAAGTTCAAGAAGTATTTCTTCTTCAAACGCTTCCACTCTATCACGCAGGAGCACGTGCTTGAACGCGTTCTTCCCCCGTCACTG
GTTGTCGATATGCGCATGTTCCAGCTGCAGCCCATGATCGTCAAGGTGGCGTTCCTCGTCGGCATGGAGGATTCAGTCACGCGCATGCTCATATCTCTCT
TCACCCAAGTGCTGTATGTCAAGGACGAGTTCATCTGCCATTTCGGTGAAGAAGGAAGCGAAATGTTTTTCATCTACACTGGTGTATTAGACATTTACAT
CCCATTGCTACCGCATGCAGGTGGCAACGGGGCGGGTGGTCGCACTGTCGCCTTCCCAACCGCTCCTTCTGGCGCTCGAGTTAGCCTCAGCGGATTGCGG
AAAGTGAATGAGATCACGGCCGGAAGCTACTTCGGAGAGGCGGCCCTATTCACGAATACTCCGCGTAATGCGTACGTGAAAGCCAACACGTCATGCATCC
TCTACAAGCTGTCGCGCCATTCATTGGAGTTGGTGTTCGTACGCTACCCTGAATGGCAGCAAAAGGTATTGCGAATTGTCAAGATTCAGCAGCAGCAACA
ACGATTGCAACGTCTTGCCTACGAGGCGCAAGCTCCCGATGGTGGGCCCGCTAATCGTCGCCGTGGACTCCGGCGAACCGCGTCACGTATGGACCTGGTC
AATGCTCGGGCGGAGAACATTGAGCAGCTCCTTCTGAGTCACCGAAAGGGGCCAAACTCGACAGAGGACGCCCCTCGCCGGTTAAAGACTTGGATTATCC
AGCAGTGGCGAAAGCTCCGGGCAGCGAAGTTGGTCCTACGCTGGGTGGTTCCAGCGTTGCGTTCGCTACAGGAAATAGCGAAGCAGCTCGCACATGGCGC
AGAGATTCAGAGCCTATTCTACCTTCAGTGGATGAGACTTTTATCTATCTGCACAGTCTACGTGGCTGTGATGATACCTTACCGCCTAACGTACGACTCA
CTCGACAGGTGGAACGTGATTCCCGTGTGCTTGCGCATTATTGAAGCGCTGTGTGAGGTGGTCTTCTGGGTGGATATCTGGTTTCAATTCCACATGCGAA
CAAACCAAGCAGCCATGGAGCTGTACGAGCAGGACCAGCTCGTGGGGTACAAGCGCGAACGTTTAGCTCTCGATCTAGCAGCTACGTTCCCGTTAAACCA
CTTCGCCACAAGCTTTTCGAGTGGACCAAGTCGACTGCTACTTTGTAAATGGCTGCGCCTCAACCGCTGCTTGAAAGTGGTCAACCTCGTGTACTACCGC
AATGAGATCACGCGTCGTAGCGTGTCATACGAGGTGAACCGCGCCCAAACGCTCTGGCTGTTGTACCTGCTGGCAATGTTTTGGACTTCGTGTGCTTACT
TCGCAGTTTCGATTTACGATGGCTTTGGTACCGAGTGGCAGAACTGGCTGCCGTCGTCTTTGCTGGATTCGGATGACCCATCGCCCGAGTTGCTGATGAT
GAGACTCTTCCGAGGTTTGTCTTTTGCGGTCACGGCTTTCGTGAAGAAAAGCAGAACATTTGTACCGGCCTCGCAGCTTAACTTTGCGTTCACCATTGTG
ATCTCATTCGTCGGCCAGCTTATCATGGCCCTCATGATCGCGGAGATGGCCAACGTGTTTTTGCTATACATCGACAACGAGGTCCAGTTTCGCAAGAACC
ACCTCATTGTTGAACGCTCCTTGGCTCGATGGAAAGTCAGCACGGCGCTGAAGCAGCGCGCTGATAACTTCCTTACGTCGTGGTGGTCTTCGCACGCAGG
CGTCGACTACCAGCTTATATTCGAAGACCTACCAGCGAGCGTTCGAACCGAGGGTATCATGGTCATCGCCAAACAACCGCTCAGTTTGTTTATGTATCAA
GTGTTTCGACCGCTTATCCGCGGAGGCATTCACGGCGATGGAGACGCTGAGAGTGGAGACGCTAACAAGGGCGAGGAAAAAGCTGAGGACAAGGGTGCGG
GTGCTGAAGAGGTTGAAAAGCCGGACTATGGTGTGACGTTCCACATCGCAAACCTCACGTACTCGATAGCGAAGTGCCTTCGCTTCGAAGGATATCCACG
AGGAGAAGCAGTCATTGTCGAAGGCAGCGTGTGCAAGGCCATGTACTTTGTGGTTCGAGGCTACCTGTTGTCCAAGAGCGTGTCCAACCCACTCATGTAC
CCCGCTAACCGCTACAGGGGAGGTGACTATATAGGAGAAATCGGGCTGCTTGGCCACTCCGTGAGCCTCATGACGGTTACAACCATCCGCGCGTGCGACC
TGTTCGTACTGAAGTCTGAGCACCTGCTACAAGTGCTTCAGTCGCACCCGTACTTTAGTCTGGTACTTGCAACTGCGCAGCTTGCGGTACAGCAGAAGAA
GAGTACGAGTGAGTTCGTTACCGAATGGTTCAGTAGCAACGATGACGACGAAGAGATTGAGAGCAGTGCTAGCAGTGGCGATGACAGCGATGAAGACGAA
GAAGAAGACGAAGATGTAGTCGACGAGGCCAACGCAAACGGTGGCATCGTGAGTGAAGACATGAAACTGAGGCGAGGGAGCCAACAGCTAAGGCGGGCGC
TGCGAGGAGCATCTCCGGAAGTTATGGAGGCGTGGGAGAACACATTCGAGCTTTTCATGGAGCTACTAGAGCCCAAGGGGAGTATGGGCGTCGCAGAAAT
CCAAGCTGATTGCTGA